ProsmORF-pred
Result : EXP01585
Protein Information
Information Type Description
Protein name EXP01585
NCBI Accession ID NC_000913.3
Organism Escherichia coli K12
Left 578600
Right 578893
Strand -
Nucleotide Sequence ATGAAAAAAATGCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTCAACAGACATTTACTGTTCAAAACAAACAGACAGCAGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCTAAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATTACTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTGTATTGCTCAAAATAA
Sequence MKKMLLATALALLITGCAQQTFTVQNKQTAVAPKETITHHFFVSGIGQKKTVDAAKICGGAENVVKTETQQTFVNGLLGFITLGIYTPLEARVYCSK
Source of smORF Protein-level
Function cellular response to magnesium ion [GO:0071286];plasma membrane [GO:0005886]
The ORF matches to the profile of pfam06291. Profile Description: Bor protein. This family consists of several Bacteriophage lambda Bor and Escherichia coli Iss proteins. Expression of bor significantly increases the survival of the Escherichia coli host cell in animal serum. This property is a well known bacterial virulence determinant indeed, bor and its adjacent sequences are highly homologous to the iss serum resistance locus of the plasmid ColV2-K94, which confers virulence in animals. It has been suggested that lysogeny may generally have a role in bacterial survival in animal hosts, and perhaps in pathogenesis.
Pubmed ID 30796087
Domain CDD:399354
Functional Category Gene Ontology/Expression based functional assignment
Uniprot ID P77330
ORF Length (Amino Acid) 97
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 21
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 578600 578893 - NC_000913.3 Escherichia coli str. K-12 substr. MG1655
2 1275032 1275325 - NC_002695.2 Escherichia coli O157:H7 str. Sakai
3 1627986 1628279 - NC_002695.2 Escherichia coli O157:H7 str. Sakai
4 37199 37492 - NZ_CP068597.1 Paenibacillus sonchi
5 1221594 1221887 - NZ_AP014857.1 Escherichia albertii
6 4185307 4185597 - NZ_CP047495.1 Pectobacterium brasiliense
7 1417069 1417359 - NZ_CP017482.1 Pectobacterium polaris
8 2759660 2759950 - NZ_CP009125.1 Pectobacterium atrosepticum
9 1364508 1364798 + NZ_CP015749.1 Pectobacterium parmentieri
10 4395568 4395858 - NZ_CP015750.1 Pectobacterium wasabiae CFBP 3304
11 3517303 3517593 - NZ_CP065640.1 Serratia rubidaea
12 2229060 2229350 - NZ_AP023184.1 Buttiauxella agrestis
13 1461899 1462189 + NZ_AP023184.1 Buttiauxella agrestis
14 3362052 3362342 + NZ_CP060111.1 Klebsiella michiganensis
15 788580 788870 + NC_010694.1 Erwinia tasmaniensis Et1/99
16 2031751 2032041 - NZ_CP065745.1 Aeromonas allosaccharophila
17 2510343 2510633 + NZ_CP013990.1 Leclercia adecarboxylata
18 52087 52383 - NC_011744.2 Vibrio atlanticus
19 755606 755896 + NZ_LN907827.1 Erwinia gerundensis
20 65977 66267 + NZ_CP034149.1 Pantoea agglomerans
21 885478 885768 - NZ_CP009354.1 Vibrio tubiashii ATCC 19109
22 3487881 3488177 - NZ_CP014864.1 Microbulbifer thermotolerans
23 411804 412055 - NZ_CP019239.1 Rhodoferax saidenbachensis
24 1185541 1185819 + NC_021883.1 Mannheimia haemolytica USMARC_2286
++ More..