Result : EXP01383
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01383 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli K12 |
| Left | 3327790 |
| Right | 3328083 |
| Strand | + |
| Nucleotide Sequence | ATGAATCTGAGTACTAAACAAAAACAGCACCTGAAAGGTCTGGCACATCCGCTCAAGCCAGTTGTTCTGCTTGGCAGTAATGGTTTGACCGAAGGGGTGCTGGCCGAGATTGAACAAGCGTTAGAGCACCATGAACTCATCAAGGTGAAAATCGCCACCGAAGATCGCGAAACTAAAACCTTGATCGTGGAAGCTATCGTGCGCGAAACCGGCGCCTGTAATGTACAGGTCATCGGTAAAACGCTGGTGCTTTATCGCCCAACTAAAGAACGTAAAATCTCGCTGCCACGCTAA |
| Sequence | MNLSTKQKQHLKGLAHPLKPVVLLGSNGLTEGVLAEIEQALEHHELIKVKIATEDRETKTLIVEAIVRETGACNVQVIGKTLVLYRPTKERKISLPR |
| Source of smORF | Protein-level |
| Function | RNA binding [GO:0003723] The ORF matches to the profile of cl00663. Profile Description: CRS1 / YhbY (CRM) domain. GFP fused to a single-domain CRM protein from maize localises to the nucleolus, suggesting that an analogous activity may have been retained in plants. A CRM domain containing protein in plant chloroplasts has been shown to function in group I and II intron splicing. In vitro experiments with an isolated maize CRM domain have shown it to have RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes. YhbY has a fold similar to that of the C-terminal domain of translation initiation factor 3 (IF3C), which binds to 16S rRNA in the 30S ribosome. |
| Pubmed ID | 30796087 |
| Domain | CDD:412505 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P71376 |
| ORF Length (Amino Acid) | 97 |
++ More..
| Conservation Analysis |
No. of Species: 328
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3833090 | 3833383 | + | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 2252601 | 2252894 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 3 | 3319972 | 3320265 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3327790 | 3328083 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 4070416 | 4070709 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 3311361 | 3311654 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 520688 | 520981 | - | NZ_CP041247.1 | Raoultella electrica |
| 8 | 1152111 | 1152404 | + | NZ_CP026047.1 | Raoultella planticola |
| 9 | 571012 | 571305 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 10 | 622538 | 622831 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 11 | 488631 | 488924 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 12 | 1322436 | 1322729 | + | NZ_CP053416.1 | Salmonella bongori |
| 13 | 661155 | 661448 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 14 | 3467488 | 3467781 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 15 | 4231171 | 4231464 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 16 | 474738 | 475031 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 17 | 1095740 | 1096033 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 18 | 5258543 | 5258836 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 19 | 2967416 | 2967709 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 20 | 3691851 | 3692144 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 21 | 3567134 | 3567427 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 22 | 3945751 | 3946044 | - | NZ_CP038469.1 | Citrobacter tructae |
| 23 | 2947695 | 2947988 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 24 | 2133484 | 2133777 | + | NZ_CP033744.1 | Citrobacter freundii |
| 25 | 342135 | 342428 | - | NZ_CP023525.1 | Cedecea neteri |
| 26 | 459564 | 459857 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 27 | 4269261 | 4269554 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 28 | 4069675 | 4069968 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 29 | 2590600 | 2590893 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 30 | 4340666 | 4340959 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 31 | 555883 | 556176 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 32 | 4768092 | 4768385 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 33 | 577241 | 577534 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 34 | 345370 | 345663 | - | NZ_LR134201.1 | Cedecea lapagei |
| 35 | 539263 | 539556 | - | NZ_CP050508.1 | Raoultella terrigena |
| 36 | 1898339 | 1898632 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 37 | 4074318 | 4074611 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 38 | 4149399 | 4149692 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 39 | 3141780 | 3142073 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 40 | 4238751 | 4239044 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 41 | 3661901 | 3662194 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 42 | 508975 | 509268 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 43 | 471663 | 471956 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 44 | 4163285 | 4163578 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 45 | 4160256 | 4160549 | + | NC_015968.1 | Enterobacter soli |
| 46 | 4188112 | 4188405 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 47 | 1774300 | 1774593 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 48 | 5350895 | 5351188 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 49 | 2865784 | 2866077 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 50 | 1131543 | 1131836 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 51 | 327318 | 327611 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 52 | 4503297 | 4503590 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 53 | 4894669 | 4894962 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 54 | 566536 | 566829 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 55 | 528964 | 529257 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 56 | 532815 | 533108 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 57 | 4746902 | 4747195 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 58 | 546531 | 546824 | - | NZ_CP054254.1 | Klebsiella variicola |
| 59 | 508200 | 508493 | - | NZ_CP061511.1 | Mixta calida |
| 60 | 408853 | 409146 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 61 | 515075 | 515368 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 62 | 506501 | 506794 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 63 | 395537 | 395830 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 64 | 4347524 | 4347817 | - | NZ_CP028271.1 | Mixta intestinalis |
| 65 | 3577195 | 3577488 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 66 | 587512 | 587805 | - | NZ_CP026377.1 | Mixta gaviniae |
| 67 | 4479520 | 4479813 | + | NC_014306.1 | Erwinia billingiae Eb661 |
| 68 | 1083105 | 1083398 | + | NZ_CP019706.1 | Pantoea alhagi |
| 69 | 4619064 | 4619357 | + | NZ_CP071320.1 | Serratia ureilytica |
| 70 | 4887390 | 4887683 | - | NZ_CP016948.1 | Serratia surfactantfaciens |
| 71 | 548985 | 549278 | - | NZ_LT906479.1 | Serratia ficaria |
| 72 | 416709 | 417002 | - | NZ_CP038662.1 | Serratia nematodiphila |
| 73 | 406452 | 406745 | - | NZ_CP048784.1 | Serratia liquefaciens |
| 74 | 407175 | 407468 | - | NZ_LR134494.1 | Serratia quinivorans |
| 75 | 467620 | 467913 | - | NC_015567.1 | Serratia plymuthica AS9 |
| 76 | 395402 | 395695 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 77 | 443421 | 443714 | - | NZ_CP034148.1 | Pantoea agglomerans |
| 78 | 3627058 | 3627351 | + | NZ_CP038853.1 | Pantoea vagans |
| 79 | 2027236 | 2027529 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 80 | 3654511 | 3654804 | + | NZ_CP045720.1 | Pantoea eucalypti |
| 81 | 603535 | 603828 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 82 | 540962 | 541255 | - | NZ_LN907827.1 | Erwinia gerundensis |
| 83 | 237796 | 238089 | + | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 84 | 3301766 | 3302059 | + | NZ_CP015749.1 | Pectobacterium parmentieri |
| 85 | 2529072 | 2529365 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 86 | 2371782 | 2372075 | - | NZ_CP011254.1 | Serratia fonticola |
| 87 | 490830 | 491123 | - | NZ_CP034035.1 | Brenneria rubrifaciens |
| 88 | 744193 | 744486 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 89 | 939711 | 940004 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 90 | 4132410 | 4132703 | + | NZ_CP051652.1 | Pectobacterium carotovorum |
| 91 | 648943 | 649236 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 92 | 4233549 | 4233842 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 93 | 683128 | 683421 | - | NZ_CP034938.1 | Pectobacterium odoriferum |
| 94 | 4521020 | 4521313 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 95 | 4018955 | 4019248 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 96 | 3539107 | 3539400 | + | NZ_CP014137.1 | Brenneria goodwinii |
| 97 | 688708 | 689001 | - | NZ_LT615367.1 | Dickeya aquatica |
| 98 | 1951984 | 1952277 | - | NZ_CP065640.1 | Serratia rubidaea |
| 99 | 3241681 | 3241974 | + | NZ_LS483470.1 | Leminorella richardii |
| 100 | 3700631 | 3700924 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 101 | 654055 | 654348 | - | NZ_CP025799.1 | Dickeya zeae |
| 102 | 3947258 | 3947551 | + | NC_012912.1 | Dickeya chrysanthemi Ech1591 |
| 103 | 4062000 | 4062293 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 104 | 676342 | 676635 | - | NZ_CP031560.1 | Dickeya dianthicola |
| 105 | 2837015 | 2837308 | - | NZ_CP015137.1 | Dickeya solani IPO 2222 |
| 106 | 667230 | 667523 | - | NC_014500.1 | Dickeya dadantii 3937 |
| 107 | 2116079 | 2116372 | + | NZ_CP009460.1 | Dickeya fangzhongdai |
| 108 | 3345442 | 3345735 | - | NZ_CP049115.1 | Pantoea stewartii |
| 109 | 3928391 | 3928684 | + | NC_012880.1 | Musicola paradisiaca Ech703 |
| 110 | 1685090 | 1685383 | - | NZ_CP023009.1 | Lonsdalea britannica |
| 111 | 3211953 | 3212246 | + | NZ_CP065534.1 | Lonsdalea populi |
| 112 | 230172 | 230465 | - | NZ_CP015581.1 | Tatumella citrea |
| 113 | 558872 | 559165 | - | NZ_CP050150.1 | Hafnia alvei |
| 114 | 1274491 | 1274784 | + | NZ_CP023706.1 | Edwardsiella tarda |
| 115 | 2173650 | 2173943 | - | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 116 | 510007 | 510300 | - | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 117 | 2592139 | 2592435 | + | NZ_CP045350.1 | Vibrio aquimaris |
| 118 | 208538 | 208834 | - | NZ_AP019657.1 | Vibrio ponticus |
| 119 | 3303055 | 3303348 | + | NZ_CP016043.1 | Edwardsiella hoshinae |
| 120 | 3968221 | 3968514 | + | NZ_CP006569.1 | Sodalis praecaptivus |
| 121 | 2447725 | 2448021 | + | NZ_CP016414.1 | Vibrio scophthalmi |
| 122 | 4158813 | 4159109 | - | NZ_CP067057.1 | Rahnella aceris |
| 123 | 2649204 | 2649497 | - | NZ_CP011078.1 | Yersinia ruckeri |
| 124 | 3394390 | 3394683 | - | NZ_CP009787.1 | Yersinia rohdei |
| 125 | 1795949 | 1796242 | - | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
| 126 | 561116 | 561409 | - | NZ_CP043727.1 | Yersinia canariae |
| 127 | 4177813 | 4178106 | + | NZ_CP011118.1 | Yersinia enterocolitica |
| 128 | 498306 | 498599 | - | NZ_CP032487.1 | Yersinia hibernica |
| 129 | 4165086 | 4165379 | + | NZ_CP046293.1 | Yersinia intermedia |
| 130 | 534993 | 535286 | - | NZ_CP029185.2 | Limnobaculum parvum |
| 131 | 2532171 | 2532467 | + | NZ_CP047475.1 | Vibrio astriarenae |
| 132 | 453610 | 453903 | - | NZ_LR134531.1 | Pragia fontium |
| 133 | 3207935 | 3208228 | - | NZ_CP009781.1 | Yersinia aldovae 670-83 |
| 134 | 474788 | 475084 | - | NZ_CP018312.1 | Vibrio rotiferianus |
| 135 | 4019831 | 4020124 | + | NZ_LR134373.1 | Yersinia pseudotuberculosis |
| 136 | 2200012 | 2200305 | - | NZ_CP007230.1 | Yersinia similis |
| 137 | 457247 | 457540 | - | NC_012779.2 | Edwardsiella ictaluri 93-146 |
| 138 | 2717987 | 2718283 | + | NZ_CP044069.1 | Vibrio vulnificus |
| 139 | 2565433 | 2565729 | + | NZ_CP030788.1 | Vibrio campbellii |
| 140 | 2515472 | 2515768 | - | NZ_CP019959.1 | Vibrio owensii |
| 141 | 3129134 | 3129430 | + | NZ_CP009467.1 | Vibrio harveyi |
| 142 | 2325553 | 2325849 | + | NZ_CP040021.1 | Salinivibrio kushneri |
| 143 | 682904 | 683200 | - | NZ_CP031781.1 | Vibrio parahaemolyticus |
| 144 | 336087 | 336383 | - | NZ_CP009977.1 | Vibrio natriegens NBRC 15636 = ATCC 14048 = DSM 759 |
| 145 | 1108681 | 1108977 | - | NC_013456.1 | Vibrio antiquarius |
| 146 | 2937127 | 2937423 | - | NZ_CP025792.1 | Vibrio jasicida 090810c |
| 147 | 518539 | 518835 | - | NZ_CP009354.1 | Vibrio tubiashii ATCC 19109 |
| 148 | 1851630 | 1851926 | + | NZ_AP018689.1 | Vibrio aphrogenes |
| 149 | 3339459 | 3339752 | + | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
| 150 | 2995750 | 2996043 | + | NZ_CP016176.1 | Xenorhabdus hominickii |
| 151 | 1904433 | 1904729 | - | NZ_CP014056.2 | Grimontia hollisae |
| 152 | 526616 | 526912 | - | NZ_AP014524.1 | Vibrio cholerae MS6 |
| 153 | 780855 | 781151 | - | NZ_AP018685.1 | Vibrio rumoiensis |
| 154 | 663350 | 663646 | - | NZ_CP032093.1 | Vibrio alfacsensis |
| 155 | 567796 | 568092 | - | NZ_CP022741.1 | Vibrio qinghaiensis |
| 156 | 2413494 | 2413790 | - | NZ_CP046793.1 | Vibrio metschnikovii |
| 157 | 366231 | 366524 | - | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
| 158 | 3593102 | 3593398 | + | NZ_CP005974.1 | Photobacterium gaetbulicola Gung47 |
| 159 | 5299591 | 5299884 | + | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
| 160 | 282472 | 282768 | - | NZ_CP035688.1 | Vibrio metoecus |
| 161 | 2344938 | 2345234 | + | NZ_CP033078.1 | Vibrio zhugei |
| 162 | 651666 | 651962 | - | NC_011312.1 | Aliivibrio salmonicida LFI1238 |
| 163 | 4028244 | 4028537 | + | NZ_CP072455.1 | Xenorhabdus budapestensis |
| 164 | 1343598 | 1343891 | - | NZ_CP023536.1 | Providencia alcalifaciens |
| 165 | 185011 | 185307 | - | NZ_CP014035.2 | Vibrio fluvialis |
| 166 | 3153511 | 3153807 | + | NZ_CP040990.1 | Vibrio furnissii |
| 167 | 2904707 | 2905003 | + | NZ_CP070624.1 | Photobacterium damselae subsp. damselae |
| 168 | 3010075 | 3010368 | + | NZ_CP060401.1 | Xenorhabdus nematophila |
| 169 | 441956 | 442249 | - | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 170 | 1662540 | 1662836 | + | NZ_LT960611.1 | Vibrio tapetis subsp. tapetis |
| 171 | 654632 | 654928 | - | NZ_CP046268.1 | Vibrio spartinae |
| 172 | 2864434 | 2864730 | + | NZ_CP071325.1 | Photobacterium ganghwense |
| 173 | 4702897 | 4703190 | + | NC_012962.1 | Photorhabdus asymbiotica |
| 174 | 2090607 | 2090903 | - | NZ_CP065150.1 | Vibrio kanaloae |
| 175 | 2664428 | 2664724 | + | NC_011753.2 | Vibrio atlanticus |
| 176 | 618640 | 618936 | - | NZ_CP039700.1 | Vibrio cyclitrophicus |
| 177 | 2898599 | 2898895 | + | NZ_AP014635.1 | Vibrio tritonius |
| 178 | 3948115 | 3948408 | + | NZ_LS483422.1 | Providencia heimbachae |
| 179 | 2387538 | 2387831 | - | NZ_CP011104.1 | Photorhabdus thracensis |
| 180 | 3928894 | 3929187 | + | NZ_CP048796.1 | Providencia vermicola |
| 181 | 1396925 | 1397224 | - | NZ_CP028897.1 | Dongshaea marina |
| 182 | 1026003 | 1026302 | - | NZ_CP069213.1 | Shewanella litorisediminis |
| 183 | 1152075 | 1152374 | - | NC_008700.1 | Shewanella amazonensis SB2B |
| 184 | 3682013 | 3682312 | + | NZ_CP046378.1 | Shewanella algae |
| 185 | 1851588 | 1851881 | - | NZ_CP026364.1 | Proteus hauseri |
| 186 | 1126726 | 1127019 | - | NZ_CP029736.1 | Providencia rettgeri |
| 187 | 3413498 | 3413791 | + | NZ_CP031123.2 | Providencia huaxiensis |
| 188 | 559322 | 559621 | - | NZ_CP020373.1 | Shewanella khirikhana |
| 189 | 3741636 | 3741935 | + | NC_014012.1 | Shewanella violacea DSS12 |
| 190 | 1310226 | 1310525 | + | NZ_CP036200.1 | Shewanella maritima |
| 191 | 2307811 | 2308104 | + | NZ_CP036536.1 | Salinimonas lutimaris |
| 192 | 1863094 | 1863330 | + | NZ_LT906463.1 | Haemophilus pittmaniae |
| 193 | 3992434 | 3992733 | + | NC_016901.1 | Shewanella baltica OS678 |
| 194 | 1744747 | 1745049 | + | NZ_LR134327.1 | Aggregatibacter aphrophilus ATCC 33389 |
| 195 | 276493 | 276786 | - | NZ_CP047349.1 | Proteus terrae subsp. cibarius |
| 196 | 457969 | 458268 | + | NZ_CP040863.1 | Rodentibacter heylii |
| 197 | 56603 | 56899 | - | NZ_CP034759.1 | Litorilituus sediminis |
| 198 | 3242121 | 3242357 | + | NC_014541.1 | Ferrimonas balearica DSM 9799 |
| 199 | 1074593 | 1074889 | - | NZ_CP029347.1 | Saliniradius amylolyticus |
| 200 | 1326338 | 1326634 | - | NZ_LR134167.1 | Avibacterium volantium |
| 201 | 3736381 | 3736674 | - | NC_010554.1 | Proteus mirabilis HI4320 |
| 202 | 1032454 | 1032750 | + | NC_006512.1 | Idiomarina loihiensis L2TR |
| 203 | 1011669 | 1011965 | - | NC_008709.1 | Psychromonas ingrahamii 37 |
| 204 | 2030870 | 2031163 | - | NZ_CP008849.1 | Alteromonas australica |
| 205 | 4845455 | 4845754 | + | NZ_CP014782.1 | Shewanella psychrophila |
| 206 | 2474033 | 2474326 | + | NC_012691.1 | Tolumonas auensis DSM 9187 |
| 207 | 1499103 | 1499396 | + | NZ_CP014322.1 | Alteromonas addita |
| 208 | 2129537 | 2129830 | + | NC_015554.1 | Alteromonas naphthalenivorans |
| 209 | 1214841 | 1215140 | - | NC_011566.1 | Shewanella piezotolerans WP3 |
| 210 | 1731827 | 1732123 | - | NZ_CP017689.1 | Thalassotalea crassostreae |
| 211 | 3581529 | 3581828 | + | NZ_CP022358.1 | Shewanella bicestrii |
| 212 | 1361376 | 1361675 | - | NZ_LS483458.1 | Haemophilus haemolyticus |
| 213 | 566474 | 566776 | - | NZ_CP015031.1 | Basfia succiniciproducens |
| 214 | 1137462 | 1137761 | - | NC_007954.1 | Shewanella denitrificans OS217 |
| 215 | 1923737 | 1924030 | - | NZ_CP031769.1 | Salinimonas sediminis |
| 216 | 3493110 | 3493412 | + | NZ_CP041036.1 | Shewanella polaris |
| 217 | 757374 | 757682 | + | NZ_CP006954.1 | Bibersteinia trehalosi USDA-ARS-USMARC-188 |
| 218 | 4611533 | 4611832 | + | NZ_CP037952.1 | Parashewanella spongiae |
| 219 | 970636 | 970950 | + | NC_011852.1 | Glaesserella parasuis SH0165 |
| 220 | 1349042 | 1349338 | - | NZ_CP020465.1 | Cognaticolwellia beringensis |
| 221 | 1041348 | 1041644 | - | NZ_CP012621.1 | Zobellella denitrificans |
| 222 | 279491 | 279787 | - | NZ_CP009056.1 | Frischella perrara |
| 223 | 1478125 | 1478424 | + | NZ_CP009610.1 | Haemophilus influenzae |
| 224 | 1564639 | 1564938 | + | NZ_LS483429.1 | Haemophilus aegyptius |
| 225 | 1146836 | 1147135 | - | NC_008345.1 | Shewanella frigidimarina NCIMB 400 |
| 226 | 4141790 | 4142089 | + | NC_009831.1 | Shewanella sediminis HAW-EB3 |
| 227 | 4358761 | 4359060 | + | NC_010506.1 | Shewanella woodyi ATCC 51908 |
| 228 | 4030161 | 4030457 | - | NZ_CP052766.1 | Alteromonas pelagimontana |
| 229 | 1519230 | 1519529 | - | NZ_CP034015.1 | Shewanella livingstonensis |
| 230 | 938067 | 938369 | - | NC_006300.1 | [Mannheimia] succiniciproducens MBEL55E |
| 231 | 544419 | 544736 | - | NZ_CP007715.1 | Actinobacillus equuli subsp. equuli |
| 232 | 547262 | 547579 | - | NZ_CP009159.1 | Actinobacillus suis ATCC 33415 |
| 233 | 3764754 | 3765053 | + | NC_009901.1 | Shewanella pealeana ATCC 700345 |
| 234 | 3852992 | 3853291 | + | NC_010334.1 | Shewanella halifaxensis HAW-EB4 |
| 235 | 894707 | 895003 | - | NC_007481.1 | Pseudoalteromonas translucida |
| 236 | 958737 | 959033 | - | NZ_CP011036.1 | Pseudoalteromonas nigrifaciens |
| 237 | 980355 | 980651 | + | NZ_CP018804.1 | Histophilus somni |
| 238 | 1334198 | 1334500 | - | NZ_LS483443.1 | Aggregatibacter segnis ATCC 33393 |
| 239 | 1390488 | 1390796 | + | NZ_CP029206.1 | Actinobacillus porcitonsillarum |
| 240 | 1067061 | 1067357 | - | NZ_CP033065.1 | Pseudoalteromonas agarivorans |
| 241 | 2592423 | 2592719 | + | NZ_CP023464.1 | Pseudoalteromonas atlantica |
| 242 | 1136771 | 1137067 | - | NZ_CP011028.1 | Pseudoalteromonas espejiana DSM 9414 |
| 243 | 3589633 | 3589929 | + | NC_003910.7 | Colwellia psychrerythraea 34H |
| 244 | 3070534 | 3070833 | - | NZ_CP021377.1 | Oceanisphaera profunda |
| 245 | 1993032 | 1993331 | + | NZ_CP041783.1 | Shewanella donghaensis |
| 246 | 423670 | 423963 | + | NZ_LR134510.1 | Actinobacillus delphinicola |
| 247 | 1128140 | 1128436 | - | NZ_CP011025.1 | Pseudoalteromonas arctica A 37-1-2 |
| 248 | 2301548 | 2301844 | + | NC_016041.1 | Glaciecola nitratireducens FR1064 |
| 249 | 1986824 | 1987126 | - | NZ_CP028926.1 | Pasteurella multocida |
| 250 | 1716424 | 1716738 | + | NZ_CP046531.1 | Mannheimia ovis |
| 251 | 3760597 | 3760896 | + | NZ_CP020472.1 | Shewanella japonica |
| 252 | 2408017 | 2408313 | + | NZ_CP011041.1 | Pseudoalteromonas tetraodonis |
| 253 | 2381730 | 2382026 | + | NZ_CP011030.1 | Pseudoalteromonas issachenkonii |
| 254 | 3384076 | 3384375 | + | NZ_CP037951.1 | Parashewanella tropica |
| 255 | 2540714 | 2541010 | + | NZ_CP027523.1 | Pseudoalteromonas carrageenovora |
| 256 | 1620223 | 1620492 | + | NC_021883.1 | Mannheimia haemolytica USMARC_2286 |
| 257 | 4479926 | 4480222 | + | NZ_CP019628.1 | Pseudoalteromonas aliena |
| 258 | 1490241 | 1490555 | - | NZ_CP015425.1 | [Haemophilus] ducreyi |
| 259 | 1159852 | 1160151 | - | NZ_CP022272.1 | Shewanella marisflavi |
| 260 | 3361723 | 3362022 | + | NC_009092.1 | Shewanella loihica PV-4 |
| 261 | 1547775 | 1548068 | - | NZ_CP013187.1 | Pseudoalteromonas phenolica |
| 262 | 1251555 | 1251833 | - | NZ_CP061280.1 | Mannheimia bovis |
| 263 | 1801063 | 1801377 | + | NZ_CP055305.1 | Mannheimia pernigra |
| 264 | 1951247 | 1951540 | - | NZ_CP046670.1 | Alteromonas mediterranea |
| 265 | 2901184 | 2901480 | - | NZ_CP072425.1 | Pseudoalteromonas viridis |
| 266 | 1206108 | 1206422 | - | NZ_CP016604.1 | Otariodibacter oris |
| 267 | 1378992 | 1379270 | + | NZ_CP015029.1 | Frederiksenia canicola |
| 268 | 852392 | 852688 | - | NZ_CP016605.1 | Bisgaardia hudsonensis |
| 269 | 1109619 | 1109918 | + | NZ_CP021376.1 | Oceanisphaera avium |
| 270 | 706672 | 706974 | - | NZ_LT906448.1 | Pasteurella dagmatis |
| 271 | 2863984 | 2864277 | - | NZ_CP007445.1 | Gilliamella apicola |
| 272 | 2364298 | 2364594 | + | NZ_CP032090.1 | Pseudoalteromonas donghaensis |
| 273 | 4611474 | 4611770 | - | NZ_CP051883.1 | Aeromonas salmonicida |
| 274 | 3770708 | 3771004 | + | NZ_CP050851.1 | Aeromonas hydrophila |
| 275 | 491185 | 491502 | - | NZ_CP030753.1 | Actinobacillus pleuropneumoniae |
| 276 | 3383656 | 3383949 | - | NZ_CP072133.1 | Pseudoalteromonas xiamenensis |
| 277 | 2763519 | 2763812 | + | NZ_CP031416.1 | Gallaecimonas mangrovi |
| 278 | 1323901 | 1324215 | + | NZ_CP006944.1 | Mannheimia varigena USDA-ARS-USMARC-1312 |
| 279 | 593617 | 593856 | - | NZ_CP051180.1 | Ferrimonas lipolytica |
| 280 | 566819 | 567115 | - | NZ_CP031961.1 | Pseudoalteromonas tunicata |
| 281 | 609499 | 609795 | - | NZ_CP040449.1 | Aeromonas simiae |
| 282 | 1258541 | 1258855 | + | NZ_CP016180.1 | Pasteurella skyensis |
| 283 | 4156357 | 4156653 | - | NZ_CP044060.1 | Aeromonas veronii |
| 284 | 2615893 | 2616189 | + | NZ_CP065745.1 | Aeromonas allosaccharophila |
| 285 | 1117143 | 1117439 | - | NZ_AP022188.1 | Aeromonas media |
| 286 | 1820248 | 1820544 | - | NZ_CP009888.1 | Pseudoalteromonas piratica |
| 287 | 1057338 | 1057634 | - | NZ_LR134376.1 | Aeromonas encheleia |
| 288 | 2634835 | 2635131 | - | NZ_CP041660.1 | Catenovulum sediminis |
| 289 | 58034 | 58330 | - | NZ_CP044399.1 | Moritella marina ATCC 15381 |
| 290 | 1102095 | 1102391 | - | NZ_CP011039.1 | Pseudoalteromonas spongiae UST010723-006 |
| 291 | 3857112 | 3857408 | - | NZ_LS483250.1 | Moritella yayanosii |
| 292 | 2540338 | 2540637 | + | NZ_CP072844.1 | Psychrosphaera aestuarii |
| 293 | 913688 | 913981 | - | NZ_CP022355.1 | Paraphotobacterium marinum |
| 294 | 4286303 | 4286542 | + | NZ_AP014940.1 | Lysobacter enzymogenes |
| 295 | 2942678 | 2942929 | - | NZ_CP037953.1 | Permianibacter aggregans |
| 296 | 2371342 | 2371638 | + | NZ_CP025120.1 | Kangiella profundi |
| 297 | 1213417 | 1213656 | - | NZ_CP046603.1 | Lysobacter soli |
| 298 | 1959984 | 1960277 | - | NC_017857.3 | Methylophaga nitratireducenticrescens |
| 299 | 4157962 | 4158255 | + | NZ_CP023465.1 | Lysobacter capsici |
| 300 | 2035061 | 2035378 | + | NZ_CP046415.1 | Guyparkeria halophila |
| 301 | 1592144 | 1592452 | + | NZ_CP022684.1 | Ketobacter alkanivorans |
| 302 | 959256 | 959492 | - | NZ_AP018722.1 | Thiomicrorhabdus aquaedulcis |
| 303 | 249630 | 249926 | - | NZ_CP012418.1 | Kangiella sediminilitoris |
| 304 | 1100237 | 1100500 | - | NZ_CP033040.1 | Thiomicrorhabdus indica |
| 305 | 1263718 | 1263954 | - | NZ_CP041242.1 | Lysobacter alkalisoli |
| 306 | 2540102 | 2540341 | + | NZ_LT853882.1 | Xanthomonas fragariae |
| 307 | 5039395 | 5039700 | - | NZ_CP018725.1 | Xanthomonas vesicatoria ATCC 35937 |
| 308 | 2400453 | 2400692 | - | NZ_CP060820.1 | Lysobacter solisilvae (ex Woo and Kim 2020) |
| 309 | 220271 | 220582 | - | NZ_CP010975.1 | Kangiella geojedonensis |
| 310 | 2247193 | 2247495 | + | NC_008340.1 | Alkalilimnicola ehrlichii MLHE-1 |
| 311 | 1058813 | 1059103 | - | NC_011901.1 | Thioalkalivibrio sulfidiphilus HL-EbGr7 |
| 312 | 1150180 | 1150455 | - | NZ_CP038017.1 | Allofrancisella frigidaquae |
| 313 | 3485310 | 3485576 | + | NZ_LT906442.1 | Legionella waltersii |
| 314 | 1232522 | 1232800 | - | NZ_CP043552.1 | Francisella marina |
| 315 | 1821601 | 1821879 | - | NC_015696.1 | Francisella salina |
| 316 | 532950 | 533225 | + | NZ_CP038241.1 | Allofrancisella inopinata |
| 317 | 5526815 | 5527123 | + | NZ_CP027756.1 | Pseudomonas synxantha |
| 318 | 1087118 | 1087399 | + | NZ_CP031700.1 | Neisseria zalophi |
| 319 | 1544727 | 1545005 | - | NZ_CP022132.1 | Francisella halioticida |
| 320 | 1027533 | 1027814 | + | NZ_CP009654.1 | Francisella frigiditurris |
| 321 | 1533240 | 1533515 | - | NZ_CP010427.1 | Allofrancisella guangzhouensis |
| 322 | 3162052 | 3162318 | + | NZ_CP013742.1 | Legionella pneumophila |
| 323 | 5179987 | 5180295 | + | NZ_CP049044.1 | Pseudomonas psychrophila |
| 324 | 1664300 | 1664578 | - | NZ_CP016796.1 | Francisella uliginis |
| 325 | 585504 | 585782 | + | NC_023029.1 | Francisella orientalis LADL--07-285A |
| 326 | 3629953 | 3630195 | + | NC_015572.1 | Methylomonas methanica MC09 |
| 327 | 114074 | 114355 | + | NZ_LR134533.1 | Neisseria weaveri |
| 328 | 1195948 | 1196196 | + | NZ_CP059569.1 | Kingella oralis |
| 329 | 1023496 | 1023762 | + | NZ_CP014476.1 | Methylomonas denitrificans |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02878.18 | 0.85 | 279 | 3730.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
| 2 | PF02880.18 | 0.85 | 279 | 3730.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
| 3 | PF02879.18 | 0.85 | 279 | 3730.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II |
| 4 | PF00408.22 | 0.83 | 272 | 3730 | opposite-strand | Phosphoglucomutase/phosphomannomutase, C-terminal domain |
| 5 | PF00809.24 | 0.89 | 291 | 2882.5 | opposite-strand | Pterin binding enzyme |
| 6 | PF01434.20 | 0.91 | 297 | 829.5 | opposite-strand | Peptidase family M41 |
| 7 | PF00004.31 | 0.91 | 297 | 829.5 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 8 | PF06480.17 | 0.87 | 284 | 832 | opposite-strand | FtsH Extracellular |
| 9 | PF17862.3 | 0.9 | 296 | 832 | opposite-strand | AAA+ lid domain |
| 10 | PF07728.16 | 0.9 | 294 | 826.5 | opposite-strand | AAA domain (dynein-related subfamily) |
| 11 | PF01728.21 | 0.89 | 292 | 126 | opposite-strand | FtsJ-like methyltransferase |
| 12 | PF03449.17 | 0.78 | 256 | 129 | opposite-strand | Transcription elongation factor, N-terminal |
| 13 | PF01272.21 | 0.78 | 256 | 129 | opposite-strand | Transcription elongation factor, GreA/GreB, C-term |
| 14 | PF02113.17 | 0.6 | 197 | 876.0 | same-strand | D-Ala-D-Ala carboxypeptidase 3 (S13) family |
++ More..