ProsmORF-pred
Result : EXP01358
Protein Information
Information Type Description
Protein name EXP01358
NCBI Accession ID NC_000964.3
Organism Bacillus subtilus 168
Left 3335414
Right 3335545
Strand +
Nucleotide Sequence ATGGGATTCTACAATTCTGGTGGATACAGTGGAAACTCTGGTTACTCAAACGGTTTCGGGAGCTCCTTCGCTTTGATCGTGGTGCTATTCATTTTGTTGATCATTGTTGGAGCAGCTATCTTTAATTATTAA
Sequence MGFYNSGGYSGNSGYSNGFGSSFALIVVLFILLIIVGAAIFNY
Source of smORF Literature
Function integral component of membrane [GO:0016021]
The ORF matches to the profile of cl29742. Profile Description: Protein of unknown function (Tiny_TM_bacill). This model represents a family of hypothetical proteins, half of which are 40 residues or less in length. Members are found only in spore-forming species. A Gly-rich variable region is followed by a strongly conserved, highly hydrophobic region, predicted to form a transmembrane helix, ending with an invariant Gly. The consensus for this stretch is FALLVVFILLIIV. [Hypothetical proteins, Conserved]
Pubmed ID 30796087
Domain CDD:421897
Functional Category Gene Ontology/Expression based functional assignment
Uniprot ID C0H3Q7
ORF Length (Amino Acid) 43
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 18
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 3335414 3335545 + NC_000964.3 Bacillus subtilis subsp. subtilis str. 168
2 1751899 1752033 - NZ_CP031223.1 Psychrobacillus glaciei
3 2018936 2019064 - NZ_CP031223.1 Psychrobacillus glaciei
4 1707880 1708005 + NZ_CP016020.1 Bacillus weihaiensis
5 1362631 1362744 - NZ_CP016622.1 Parageobacillus thermoglucosidasius
6 673300 673410 - NC_006510.1 Geobacillus kaustophilus HTA426
7 3340199 3340309 - NZ_CP061470.1 Geobacillus zalihae
8 3331947 3332057 + NZ_CP018058.1 Geobacillus thermocatenulatus
9 1612126 1612236 + NZ_CP061472.1 Geobacillus thermoleovorans
10 3124774 3124884 + NZ_CP063356.1 Anaerobacillus isosaccharinicus
11 846476 846616 + NZ_CP014616.1 Sporosarcina psychrophila
12 2117557 2117688 + NZ_CP017703.1 Aeribacillus pallidus
13 2617690 2617824 - NZ_CP017703.1 Aeribacillus pallidus
14 99343 99471 - NZ_CP038015.1 Paenisporosarcina antarctica
15 1121902 1122021 - NZ_CP015108.1 Sporosarcina ureae
16 1223363 1223482 + NZ_CP009416.1 Jeotgalibacillus malaysiensis
17 2024541 2024648 - NZ_CP024848.1 Oceanobacillus zhaokaii
18 1898860 1898970 - NC_006270.3 Bacillus licheniformis DSM 13 = ATCC 14580
19 2624853 2624963 + NZ_CP014342.1 Geobacillus subterraneus
20 3655227 3655361 - NZ_CP022983.1 Cytobacillus kochii
++ More..