| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01358 |
| NCBI Accession ID | NC_000964.3 |
| Organism | Bacillus subtilus 168 |
| Left | 3335414 |
| Right | 3335545 |
| Strand | + |
| Nucleotide Sequence | ATGGGATTCTACAATTCTGGTGGATACAGTGGAAACTCTGGTTACTCAAACGGTTTCGGGAGCTCCTTCGCTTTGATCGTGGTGCTATTCATTTTGTTGATCATTGTTGGAGCAGCTATCTTTAATTATTAA |
| Sequence | MGFYNSGGYSGNSGYSNGFGSSFALIVVLFILLIIVGAAIFNY |
| Source of smORF | Literature |
| Function | integral component of membrane [GO:0016021] The ORF matches to the profile of cl29742. Profile Description: Protein of unknown function (Tiny_TM_bacill). This model represents a family of hypothetical proteins, half of which are 40 residues or less in length. Members are found only in spore-forming species. A Gly-rich variable region is followed by a strongly conserved, highly hydrophobic region, predicted to form a transmembrane helix, ending with an invariant Gly. The consensus for this stretch is FALLVVFILLIIV. [Hypothetical proteins, Conserved] |
| Pubmed ID | 30796087 |
| Domain | CDD:421897 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | C0H3Q7 |
| ORF Length (Amino Acid) | 43 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3335414 | 3335545 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 1751899 | 1752033 | - | NZ_CP031223.1 | Psychrobacillus glaciei |
| 3 | 2018936 | 2019064 | - | NZ_CP031223.1 | Psychrobacillus glaciei |
| 4 | 1707880 | 1708005 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 5 | 1362631 | 1362744 | - | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 6 | 673300 | 673410 | - | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 7 | 3340199 | 3340309 | - | NZ_CP061470.1 | Geobacillus zalihae |
| 8 | 3331947 | 3332057 | + | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 9 | 1612126 | 1612236 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 10 | 3124774 | 3124884 | + | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 11 | 846476 | 846616 | + | NZ_CP014616.1 | Sporosarcina psychrophila |
| 12 | 2117557 | 2117688 | + | NZ_CP017703.1 | Aeribacillus pallidus |
| 13 | 2617690 | 2617824 | - | NZ_CP017703.1 | Aeribacillus pallidus |
| 14 | 99343 | 99471 | - | NZ_CP038015.1 | Paenisporosarcina antarctica |
| 15 | 1121902 | 1122021 | - | NZ_CP015108.1 | Sporosarcina ureae |
| 16 | 1223363 | 1223482 | + | NZ_CP009416.1 | Jeotgalibacillus malaysiensis |
| 17 | 2024541 | 2024648 | - | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 18 | 1898860 | 1898970 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 19 | 2624853 | 2624963 | + | NZ_CP014342.1 | Geobacillus subterraneus |
| 20 | 3655227 | 3655361 | - | NZ_CP022983.1 | Cytobacillus kochii |