Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01348 |
NCBI Accession ID | Mycoplasma pneumonia M132 |
Organism | Mycoplasma pneumonia M132 |
Left | 207448 |
Right | 207717 |
Strand | + |
Nucleotide Sequence | ATGCAAAGTTGGCGCCAATGTTTAGTTACCAGAAAGTCTTTTGCTAAGCCGCTACTTTTGCGTCTTGTAAAATTAGAGCATCAACTACGGGTGGATTTAGCGCAAACACTACCAGGTCGGGGGTATTATTTAAGTGTAGCTGCTTTAAAACTGGAGCGGAAAAACTTTAAAGCACTGTTACAAAAACGCTTAAAGGTAAGCTGTTCTGACGCAGAGCTAGATCACATTATTGCTTGTTTAAAGGAAAGGGAAAGCGATGTCAAAGCATAA |
Sequence | MQSWRQCLVTRKSFAKPLLLRLVKLEHQLRVDLAQTLPGRGYYLSVAALKLERKNFKALLQKRLKVSCSDAELDHIIACLKERESDVKA |
Source of smORF | Literature |
Function | Nucleic acid binding (DNA/RNA) property as is inferred from DNA-cellulose Chromatography coupled to MS (DNAC-MS) Pubmed:25609650 The ORF matches to the profile of cl00189. Profile Description: N/A. Ylxr homologs; group of conserved hypothetical bacterial proteins of unknown function; structure revealed putative RNA binding cleft; proteins are encoded by an operon that includes other proteins involved in transcription and/or translation |
Pubmed ID | 30796087 |
Domain | CDD:412207 |
Functional Category | Manually curated function from literature |
Uniprot ID | Q2MHT0 |
ORF Length (Amino Acid) | 89 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 205751 | 206020 | + | NZ_CP010546.1 | Mycoplasma pneumoniae FH |
2 | 180746 | 181018 | + | NC_000908.2 | Mycoplasma genitalium G37 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF08529.13 | 1.0 | 2 | 969.5 | same-strand | NusA N-terminal domain |
2 | PF00009.29 | 1.0 | 2 | -13.0 | same-strand | Elongation factor Tu GTP binding domain |
3 | PF11987.10 | 1.0 | 2 | -13.0 | same-strand | Translation-initiation factor 2 |
4 | PF01926.25 | 1.0 | 2 | -13.0 | same-strand | 50S ribosome-binding GTPase |
5 | PF04760.17 | 1.0 | 2 | -13.0 | same-strand | Translation initiation factor IF-2, N-terminal region |
6 | PF00025.23 | 1.0 | 2 | -13.0 | same-strand | ADP-ribosylation factor family |
7 | PF08477.15 | 1.0 | 2 | -13.0 | same-strand | Ras of Complex, Roc, domain of DAPkinase |
8 | PF02033.20 | 1.0 | 2 | 1838.0 | same-strand | Ribosome-binding factor A |