Result : EXP01342
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01342 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli K12 |
| Left | 1987873 |
| Right | 1987959 |
| Strand | - |
| Nucleotide Sequence | ATGAAACTGCGCAAAATCCTGAAAAGTATGTTCAATAACTATTGCAAGACGTTCAAAGACGTACCGCCAGGCAATATGTTCCGATAA |
| Sequence | MKLRKILKSMFNNYCKTFKDVPPGNMFR |
| Source of smORF | Literature |
| Function | plasma membrane [GO:0005886];INDUCTION: Constitutively expressed (Pubmed:19121005) Repressed in minimal glycerol medium, at low oxygen, induced by H(2)O(2), the thiol reductant diamide, at 45 degrees Celsius and at pH 55 (Pubmed:19734316) (at protein level) Transcription is repressed by CRP Pubmed:19121005,19734316 The ORF matches to the profile of NF033642. Profile Description: stress response protein AzuC. AzuC is a basic, extremely small protein (28 amino acids in Escherichia coli K-12) whose expression is repressed by cyclic AMP response protein (CRP) and stimulated by acidic pH. |
| Pubmed ID | 30796087 |
| Domain | CDD:411256 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | C1P605 |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 56
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2589163 | 2589249 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1987873 | 1987959 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1984157 | 1984243 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2562288 | 2562374 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2552090 | 2552176 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 2755952 | 2756038 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 7 | 4237331 | 4237417 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 8 | 1918703 | 1918789 | - | NZ_AP014857.1 | Escherichia albertii |
| 9 | 4431258 | 4431341 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 10 | 2606490 | 2606573 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 11 | 2273052 | 2273135 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 12 | 2646786 | 2646869 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 13 | 2178792 | 2178875 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 14 | 2699828 | 2699911 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 15 | 2076341 | 2076424 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 16 | 1795075 | 1795158 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 17 | 2745131 | 2745214 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 18 | 1537597 | 1537680 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 19 | 803070 | 803153 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 20 | 2861281 | 2861364 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 21 | 1313233 | 1313316 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 22 | 2635206 | 2635289 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 23 | 3867588 | 3867671 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 24 | 1987120 | 1987203 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 25 | 5280105 | 5280188 | - | NZ_CP026047.1 | Raoultella planticola |
| 26 | 1925569 | 1925652 | + | NZ_CP041247.1 | Raoultella electrica |
| 27 | 3071345 | 3071428 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 28 | 2133391 | 2133474 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 29 | 34411 | 34494 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 30 | 2937729 | 2937812 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 31 | 131314 | 131397 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 32 | 1810290 | 1810379 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 33 | 1885477 | 1885560 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 34 | 88713 | 88796 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 35 | 2881361 | 2881444 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 36 | 2814898 | 2814981 | - | NC_015968.1 | Enterobacter soli |
| 37 | 688766 | 688849 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 38 | 603922 | 604005 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 39 | 2106127 | 2106210 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 40 | 2971983 | 2972066 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 41 | 1637407 | 1637490 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 42 | 3081453 | 3081536 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 43 | 4401758 | 4401841 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 44 | 2882221 | 2882304 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 45 | 1792393 | 1792476 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 46 | 2037558 | 2037641 | + | NZ_CP050508.1 | Raoultella terrigena |
| 47 | 3209449 | 3209526 | - | NZ_CP014137.1 | Brenneria goodwinii |
| 48 | 3717002 | 3717079 | - | NC_012880.1 | Musicola paradisiaca Ech703 |
| 49 | 2772808 | 2772885 | + | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 50 | 4794616 | 4794693 | + | NZ_CP017482.1 | Pectobacterium polaris |
| 51 | 3988321 | 3988398 | - | NZ_CP065044.1 | Pectobacterium aroidearum |
| 52 | 3823860 | 3823937 | - | NZ_CP051652.1 | Pectobacterium carotovorum |
| 53 | 639862 | 639939 | - | NZ_CP047495.1 | Pectobacterium brasiliense |
| 54 | 993008 | 993085 | + | NZ_CP038498.1 | Pectobacterium punjabense |
| 55 | 962042 | 962119 | + | NZ_CP034938.1 | Pectobacterium odoriferum |
| 56 | 174385 | 174462 | + | NZ_LN907827.1 | Erwinia gerundensis |
| 57 | 3287166 | 3287249 | + | NZ_CP006569.1 | Sodalis praecaptivus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012871.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00532.23 | 0.62 | 35 | 3187.5 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 2 | PF13407.8 | 0.62 | 35 | 3187.5 | same-strand | Periplasmic binding protein domain |
| 3 | PF00210.26 | 0.79 | 44 | 2212.0 | opposite-strand | Ferritin-like domain |
| 4 | PF10964.10 | 0.75 | 42 | 112 | same-strand | Protein of unknown function (DUF2766) |
| 5 | PF13992.8 | 0.68 | 38 | 2561 | opposite-strand | YecR-like lipoprotein |
| 6 | PF02502.20 | 0.62 | 35 | 1675 | same-strand | Ribose/Galactose Isomerase |
| 7 | PF12408.10 | 0.64 | 36 | 1674.5 | same-strand | Ribose-5-phosphate isomerase |
++ More..