Result : EXP01333
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01333 |
| NCBI Accession ID | BA000022.2 |
| Organism | Synechocystis sp. PCC 6803 |
| Left | 2215724 |
| Right | 2215804 |
| Strand | - |
| Nucleotide Sequence | ATGATCACCGAATTAACAGACCTGAAAAGAAACCTAGAACTAATCTCCTCTCGCCTGGGGCAAACCCAGGACTATCTTTGA |
| Sequence | MITELTDLKRNLELISSRLGQTQDYL |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 30796087 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 24
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6041889 | 6041963 | - | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
| 2 | 1595352 | 1595426 | - | NC_019689.1 | Pleurocapsa sp. PCC 7327 |
| 3 | 1139771 | 1139845 | - | NC_019780.1 | Dactylococcopsis salina PCC 8305 |
| 4 | 2348528 | 2348602 | + | NC_019776.1 | Cyanobacterium aponinum PCC 10605 |
| 5 | 4750284 | 4750358 | - | NZ_CP047242.1 | Trichormus variabilis 0441 |
| 6 | 2999629 | 2999703 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 7 | 3535059 | 3535133 | + | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 8 | 2456293 | 2456367 | + | NZ_CP042326.1 | Euhalothece natronophila Z-M001 |
| 9 | 3299839 | 3299913 | - | NC_019729.1 | Oscillatoria nigro-viridis PCC 7112 |
| 10 | 834180 | 834254 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 11 | 3282360 | 3282434 | + | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 12 | 706631 | 706705 | + | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 13 | 1635189 | 1635263 | + | NC_010628.1 | Nostoc punctiforme PCC 73102 |
| 14 | 1987648 | 1987722 | - | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
| 15 | 4524727 | 4524801 | - | NZ_CP031941.1 | Nostoc sphaeroides |
| 16 | 3844283 | 3844360 | + | NC_019753.1 | Crinalium epipsammum PCC 9333 |
| 17 | 5115742 | 5115816 | - | NC_014248.1 | 'Nostoc azollae' 0708 |
| 18 | 3767764 | 3767832 | - | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 19 | 6263739 | 6263813 | + | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 20 | 4811433 | 4811507 | - | NC_019751.1 | Calothrix sp. PCC 6303 |
| 21 | 2619150 | 2619227 | + | NZ_CP021983.2 | Halomicronema hongdechloris C2206 |
| 22 | 527341 | 527418 | - | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
| 23 | 804380 | 804457 | - | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
| 24 | 2774396 | 2774470 | + | NC_019693.1 | Oscillatoria acuminata PCC 6304 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_014501.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01219.21 | 0.67 | 16 | 2195.5 | same-strand | Prokaryotic diacylglycerol kinase |
| 2 | PF02130.19 | 0.67 | 16 | 1519.0 | same-strand | Endoribonuclease YbeY |
| 3 | PF00472.22 | 1.0 | 24 | 152 | same-strand | RF-1 domain |
++ More..