Result : EXP01330
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01330 |
| NCBI Accession ID | NC_007633.1 |
| Organism | Mycoplasma capricolum subsp. capricolum ATCC 27343 |
| Left | 277771 |
| Right | 277848 |
| Strand | - |
| Nucleotide Sequence | TTGTTGAATAACTTAATAAAGCTGCTTCAACATTTTTTACATTTAAAGCTTTTGCAAAATCAACTGCCATTTGTGTAA |
| Sequence | LLNNLIKLLQHFLHLKLLQNQLPFV |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 30796087 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 277771 | 277848 | - | NC_007633.1 | Mycoplasma capricolum subsp. capricolum ATCC 27343 |
| 2 | 301018 | 301092 | - | NZ_CP001668.1 | Mycoplasma mycoides subsp. capri str. GM12 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_007633.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00364.24 | 1.0 | 2 | 2432.0 | opposite-strand | Biotin-requiring enzyme |
| 2 | PF02817.19 | 1.0 | 2 | 3149.0 | opposite-strand | e3 binding domain |
| 3 | PF00198.25 | 1.0 | 2 | 2462.0 | opposite-strand | 2-oxoacid dehydrogenases acyltransferase (catalytic domain) |
| 4 | PF02852.24 | 1.0 | 2 | 554.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 5 | PF01515.21 | 1.0 | 2 | -75.5 | opposite-strand | Phosphate acetyl/butaryl transferase |
++ More..