Result : EXP01327
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01327 |
| NCBI Accession ID | NZ_CP001668.1 |
| Organism | Mycoplasma mycoides subsp. capri LC str. 95010 |
| Left | 29672 |
| Right | 29734 |
| Strand | - |
| Nucleotide Sequence | TTGGTCAATCTTATTGATAAAAAAGATTGTGGGAATCCCCATTTTCCTAAGTGCATGAAATAA |
| Sequence | LVNLIDKKDCGNPHFPKCMK |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 30796087 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 31
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 222898 | 222960 | - | NZ_CP034465.1 | Jeotgalibaca ciconiae |
| 2 | 2487935 | 2487997 | + | NZ_AP022822.1 | Enterococcus saigonensis |
| 3 | 2201155 | 2201217 | + | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 4 | 2138539 | 2138601 | + | NZ_CP023434.1 | Suicoccus acidiformans |
| 5 | 1996060 | 1996122 | + | NZ_CP049889.1 | Jeotgalibaca porci |
| 6 | 360203 | 360265 | + | NZ_CP054015.1 | Streptococcus gallolyticus |
| 7 | 236842 | 236904 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 8 | 592441 | 592503 | - | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 9 | 2091856 | 2091918 | + | NZ_CP039457.1 | Streptococcus pasteurianus |
| 10 | 1699124 | 1699186 | + | NZ_AP022321.1 | Veillonella nakazawae |
| 11 | 893508 | 893570 | + | NC_012924.1 | Streptococcus suis SC84 |
| 12 | 1714558 | 1714620 | + | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 13 | 1141484 | 1141546 | - | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 14 | 884897 | 884959 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 15 | 683876 | 683938 | - | NZ_LR594050.1 | Streptococcus porcinus |
| 16 | 245592 | 245654 | + | NZ_CP012805.1 | Streptococcus anginosus |
| 17 | 84346 | 84408 | + | NZ_LR134524.1 | Peptoniphilus harei |
| 18 | 1487742 | 1487804 | - | NZ_CP014159.1 | Aerococcus christensenii |
| 19 | 1059910 | 1059972 | + | NZ_CP018888.1 | Amylolactobacillus amylophilus DSM 20533 = JCM 1125 |
| 20 | 29672 | 29734 | - | NZ_CP001668.1 | Mycoplasma mycoides subsp. capri str. GM12 |
| 21 | 54023 | 54085 | + | NZ_CP044485.1 | Acinetobacter schindleri |
| 22 | 2255831 | 2255881 | - | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 23 | 6419065 | 6419115 | + | NZ_CP022464.2 | Enterocloster bolteae |
| 24 | 4779463 | 4779513 | - | NC_014393.1 | Clostridium cellulovorans 743B |
| 25 | 1137154 | 1137204 | + | NZ_CP036170.1 | [Clostridium] scindens ATCC 35704 |
| 26 | 3379426 | 3379476 | + | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
| 27 | 322968 | 323018 | + | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 28 | 2280073 | 2280123 | + | NZ_LS483306.1 | Enterococcus cecorum |
| 29 | 1421144 | 1421194 | - | NC_014246.1 | Mobiluncus curtisii ATCC 43063 |
| 30 | 546648 | 546698 | - | NZ_LT632322.1 | Murdochiella vaginalis |
| 31 | 286963 | 287013 | - | NZ_CP015578.1 | Campylobacter lanienae NCTC 13004 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP034465.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12846.9 | 0.61 | 19 | 4817 | opposite-strand | AAA-like domain |
| 2 | PF13702.8 | 0.61 | 19 | 1642 | opposite-strand | Lysozyme-like |
| 3 | PF12642.9 | 0.61 | 19 | 710 | opposite-strand | Conjugative transposon protein TcpC |
| 4 | PF00009.29 | 1.0 | 31 | -62 | opposite-strand | Elongation factor Tu GTP binding domain |
| 5 | PF03764.20 | 1.0 | 31 | -62 | opposite-strand | Elongation factor G, domain IV |
| 6 | PF00679.26 | 1.0 | 31 | -62 | opposite-strand | Elongation factor G C-terminus |
| 7 | PF14492.8 | 1.0 | 31 | -62 | opposite-strand | Elongation Factor G, domain III |
| 8 | PF01926.25 | 1.0 | 31 | -62 | opposite-strand | 50S ribosome-binding GTPase |
| 9 | PF08281.14 | 0.74 | 23 | 2728.0 | opposite-strand | Sigma-70, region 4 |
| 10 | PF04545.18 | 0.74 | 23 | 2728 | opposite-strand | Sigma-70, region 4 |
++ More..