| Protein Information | 
| Information Type | Description | 
|---|---|
| Protein name | EXP01306 | 
| NCBI Accession ID | NC_017340.1 | 
| Organism | Staphylococcus aureus 04-02981 | 
| Left | 1091454 | 
| Right | 1091588 | 
| Strand | - | 
| Nucleotide Sequence | ATGTCTAATGAAAATCAAAATAAAAAAGCAGCAGAAAAAGCTAAAGAAGTTGAAGAAAAATTAAAAGATAAAAAAGAAGAAAAAACAGAAGATATTAATCAAACAAAACAAGATATCCAAGATACACTAAATTAA | 
| Sequence | MSNENQNKKAAEKAKEVEEKLKDKKEEKTEDINQTKQDIQDTLN | 
| Source of smORF | Protein-level | 
| Function | |
| Pubmed ID | 30796087 | 
| Domain | |
| Functional Category | Function not yet assigned | 
| Uniprot ID | |
| ORF Length (Amino Acid) | 44 | 
| Conservation Analysis | 
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name | 
|---|---|---|---|---|---|
| 1 | 994194 | 994328 | - | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 | 
| 2 | 1811034 | 1811168 | + | NZ_CP035288.1 | Staphylococcus epidermidis | 
| 3 | 1568254 | 1568388 | - | NZ_CP066042.1 | Staphylococcus saccharolyticus | 
| 4 | 48242 | 48376 | - | NZ_CP022096.2 | Staphylococcus pettenkoferi | 
| 5 | 881288 | 881422 | - | NZ_CP013114.1 | Staphylococcus equorum | 
| 6 | 1862210 | 1862344 | + | NZ_CP008724.1 | Staphylococcus xylosus | 
| 7 | 701208 | 701342 | - | NZ_LT906464.1 | Staphylococcus muscae | 
| 8 | 2037691 | 2037822 | - | NZ_CP020773.1 | Staphylococcus lutrae | 
| 9 | 1543597 | 1543728 | - | NZ_CP027770.1 | Staphylococcus felis | 
| 10 | 1064562 | 1064696 | - | NZ_LR134304.1 | Staphylococcus schweitzeri | 
| Neighborhood Conservation Analysis | 
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information | 
|---|---|---|---|---|---|---|
| 1 | PF01808.20 | 0.9 | 9 | 4842 | opposite-strand | AICARFT/IMPCHase bienzyme | 
| 2 | PF02142.24 | 0.9 | 9 | 4842 | opposite-strand | MGS-like domain | 
| 3 | PF01071.21 | 1.0 | 10 | 3609.5 | opposite-strand | Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain | 
| 4 | PF02844.17 | 1.0 | 10 | 3609.5 | opposite-strand | Phosphoribosylglycinamide synthetase, N domain | 
| 5 | PF02843.18 | 1.0 | 10 | 3609.5 | opposite-strand | Phosphoribosylglycinamide synthetase, C domain | 
| 6 | PF02655.16 | 1.0 | 10 | 3609.5 | opposite-strand | ATP-grasp domain | 
| 7 | PF02361.18 | 1.0 | 10 | 2560.5 | same-strand | Cobalt transport protein | 
| 8 | PF00005.29 | 1.0 | 10 | 1167.5 | same-strand | ABC transporter | 
| 9 | PF02463.21 | 1.0 | 10 | 1167.5 | same-strand | RecF/RecN/SMC N terminal domain | 
| 10 | PF09819.11 | 1.0 | 10 | 577.5 | same-strand | ABC-type cobalt transport system, permease component | 
| 11 | PF17785.3 | 1.0 | 10 | 1801.5 | opposite-strand | PUA-like domain | 
| 12 | PF00381.21 | 1.0 | 10 | 3726.0 | opposite-strand | PTS HPr component phosphorylation site | 
| 13 | PF02896.20 | 1.0 | 10 | 3994.5 | opposite-strand | PEP-utilising enzyme, PEP-binding domain | 
| 14 | PF05524.15 | 1.0 | 10 | 3994.5 | opposite-strand | PEP-utilising enzyme, N-terminal | 
| 15 | PF00391.25 | 1.0 | 10 | 3994.5 | opposite-strand | PEP-utilising enzyme, mobile domain |