| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01306 |
| NCBI Accession ID | NC_017340.1 |
| Organism | Staphylococcus aureus 04-02981 |
| Left | 1091454 |
| Right | 1091588 |
| Strand | - |
| Nucleotide Sequence | ATGTCTAATGAAAATCAAAATAAAAAAGCAGCAGAAAAAGCTAAAGAAGTTGAAGAAAAATTAAAAGATAAAAAAGAAGAAAAAACAGAAGATATTAATCAAACAAAACAAGATATCCAAGATACACTAAATTAA |
| Sequence | MSNENQNKKAAEKAKEVEEKLKDKKEEKTEDINQTKQDIQDTLN |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 30796087 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 44 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 994194 | 994328 | - | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 2 | 1811034 | 1811168 | + | NZ_CP035288.1 | Staphylococcus epidermidis |
| 3 | 1568254 | 1568388 | - | NZ_CP066042.1 | Staphylococcus saccharolyticus |
| 4 | 48242 | 48376 | - | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 5 | 881288 | 881422 | - | NZ_CP013114.1 | Staphylococcus equorum |
| 6 | 1862210 | 1862344 | + | NZ_CP008724.1 | Staphylococcus xylosus |
| 7 | 701208 | 701342 | - | NZ_LT906464.1 | Staphylococcus muscae |
| 8 | 2037691 | 2037822 | - | NZ_CP020773.1 | Staphylococcus lutrae |
| 9 | 1543597 | 1543728 | - | NZ_CP027770.1 | Staphylococcus felis |
| 10 | 1064562 | 1064696 | - | NZ_LR134304.1 | Staphylococcus schweitzeri |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01808.20 | 0.9 | 9 | 4842 | opposite-strand | AICARFT/IMPCHase bienzyme |
| 2 | PF02142.24 | 0.9 | 9 | 4842 | opposite-strand | MGS-like domain |
| 3 | PF01071.21 | 1.0 | 10 | 3609.5 | opposite-strand | Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain |
| 4 | PF02844.17 | 1.0 | 10 | 3609.5 | opposite-strand | Phosphoribosylglycinamide synthetase, N domain |
| 5 | PF02843.18 | 1.0 | 10 | 3609.5 | opposite-strand | Phosphoribosylglycinamide synthetase, C domain |
| 6 | PF02655.16 | 1.0 | 10 | 3609.5 | opposite-strand | ATP-grasp domain |
| 7 | PF02361.18 | 1.0 | 10 | 2560.5 | same-strand | Cobalt transport protein |
| 8 | PF00005.29 | 1.0 | 10 | 1167.5 | same-strand | ABC transporter |
| 9 | PF02463.21 | 1.0 | 10 | 1167.5 | same-strand | RecF/RecN/SMC N terminal domain |
| 10 | PF09819.11 | 1.0 | 10 | 577.5 | same-strand | ABC-type cobalt transport system, permease component |
| 11 | PF17785.3 | 1.0 | 10 | 1801.5 | opposite-strand | PUA-like domain |
| 12 | PF00381.21 | 1.0 | 10 | 3726.0 | opposite-strand | PTS HPr component phosphorylation site |
| 13 | PF02896.20 | 1.0 | 10 | 3994.5 | opposite-strand | PEP-utilising enzyme, PEP-binding domain |
| 14 | PF05524.15 | 1.0 | 10 | 3994.5 | opposite-strand | PEP-utilising enzyme, N-terminal |
| 15 | PF00391.25 | 1.0 | 10 | 3994.5 | opposite-strand | PEP-utilising enzyme, mobile domain |