Result : B2S2J8
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S20 |
| NCBI Accession ID | CP000805.1 |
| Organism | Treponema pallidum subsp. pallidum (strain SS14) |
| Left | 263793 |
| Right | 264080 |
| Strand | + |
| Nucleotide Sequence | ATGGGTAGGAGTGTATCCGCCAGGAAGAGGCATGATCAGAGTGAGGTGCGTAGGATGCGTGGTAGGATGGCTAGGTCTGCGGCGCGTACTTGTGCGCGGAGGTATTTGGCTGCTGTTACATCCGGGGATAGGGAGAGTTCTCTGCCTCTACTTAGGAGCTTGGTGAAGCGACTTGACACCGCTGCCCGGAAAGGTGTTTTCGCTAGAAAGGCTGTGGCTCGCCAGAAGTCCCGAATGTGTAGACTGTACAACGGTGTGTTCTCTTCACCCGAGGTGGTGCGCGTTTGA |
| Sequence | MGRSVSARKRHDQSEVRRMRGRMARSAARTCARRYLAAVTSGDRESSLPLLRSLVKRLDTAARKGVFARKAVARQKSRMCRLYNGVFSSPEVVRV |
| Source of smORF | Swiss-Prot |
| Function | Binds directly to 16S ribosomal RNA. {ECO:0000255|HAMAP-Rule:MF_00500}. |
| Pubmed ID | 18482458 |
| Domain | CDD:412349 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | B2S2J8 |
| ORF Length (Amino Acid) | 95 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 261167 | 261454 | + | NC_015714.1 | Treponema paraluiscuniculi Cuniculi A |
| 2 | 2209256 | 2209525 | + | NZ_CP009228.1 | Treponema putidum |
| 3 | 2243180 | 2243410 | - | NC_015500.1 | Treponema brennaborense DSM 12168 |
| 4 | 1476140 | 1476409 | + | NC_022097.1 | Treponema pedis str. T A4 |
| 5 | 1765306 | 1765575 | - | NC_002967.9 | Treponema denticola ATCC 35405 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_022097.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01520.20 | 0.8 | 4 | 2995.0 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 2 | PF04620.14 | 0.8 | 4 | 1380.5 | same-strand | Flagellar filament outer layer protein Flaa |
| 3 | PF00216.23 | 1.0 | 5 | 32 | same-strand | Bacterial DNA-binding protein |
| 4 | PF00795.24 | 0.8 | 4 | 387.0 | same-strand | Carbon-nitrogen hydrolase |
| 5 | PF20154.1 | 1.0 | 5 | 380 | same-strand | Apolipoprotein N-acyltransferase N-terminal domain |
| 6 | PF04519.15 | 1.0 | 5 | 2005 | same-strand | Polymer-forming cytoskeletal |
| 7 | PF00162.21 | 0.6 | 3 | 4018 | same-strand | Phosphoglycerate kinase |
| 8 | PF04607.19 | 0.6 | 3 | 67 | same-strand | Region found in RelA / SpoT proteins |
| 9 | PF13424.8 | 0.6 | 3 | 67 | same-strand | Tetratricopeptide repeat |
| 10 | PF02464.19 | 0.6 | 3 | 2444 | same-strand | Competence-damaged protein |
++ More..