Result : EXP01260
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01260 |
| NCBI Accession ID | NC_017381.1 |
| Organism | Helicobacter pylori 2018 |
| Left | 1479083 |
| Right | 1479322 |
| Strand | + |
| Nucleotide Sequence | ATGTTTGAAAAAATACGCAAGATTTTAGCGGATATTGAAGATTCGCAAAATGAAATTGAAATGCTTTTAAAGTTAGCGAATTTGAGTTTGGGGGATTTCATTGAGATTAAAAGAGGGAGCATGGACATGCCAAAGGGCGTGAATGAAGCGTTTTTTACGCAATTAAGCGAAGAAGTGGAGCGCCTAAAGGAGCTTATCAACGCTTTGAATAAAATCAAAAAAGGGTTATTGGTGTTTTAA |
| Sequence | MFEKIRKILADIEDSQNEIEMLLKLANLSLGDFIEIKRGSMDMPKGVNEAFFTQLSEEVERLKELINALNKIKKGLLVF |
| Source of smORF | Protein-level |
| Function | The ORF matches to the profile of pfam10398. Profile Description: Protein of unknown function (DUF2443). This is a small family of highly conserved proteins from bacteria, in particular Helicobacter species, The structure is a bundle of alpha helices. The function is not known. |
| Pubmed ID | 30796087 |
| Domain | CDD:371028 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | P64665 |
| ORF Length (Amino Acid) | 79 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1563139 | 1563378 | + | NC_017379.1 | Helicobacter pylori Puno135 |
| 2 | 1552978 | 1553217 | - | NC_008229.1 | Helicobacter acinonychis str. Sheeba |
| 3 | 962807 | 963046 | + | NC_017735.1 | Helicobacter cetorum MIT 99-5656 |
| 4 | 1133454 | 1133693 | + | NC_014810.2 | Helicobacter felis ATCC 49179 |
| 5 | 1360043 | 1360282 | - | NZ_CP021886.1 | Helicobacter apodemus |
| 6 | 1883093 | 1883332 | + | NZ_LN907858.1 | Helicobacter typhlonius |
| 7 | 69741 | 69980 | + | NC_005090.1 | Wolinella succinogenes DSM 1740 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017379.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01380.24 | 0.86 | 6 | 3 | same-strand | SIS domain |
++ More..