Result : EXP01245
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01245 |
| NCBI Accession ID | NC_017381.1 |
| Organism | Helicobacter pylori 2018 |
| Left | 224629 |
| Right | 224865 |
| Strand | + |
| Nucleotide Sequence | TTGATGAAAACGACAGAAAACACAGATGAAACTCACTTAAGGGAAACTAAAAATAAACTAGGACGCAAACCAAAAACAGACGCTAATAAAAAAACTCGCGCGGTAAGCTTGTATTTTTCTGATGAGCAATACCAAAAACTAGAGAAAATGGCTAACGAAGAAGAAGAAAGCGTGGGATCTTATATCAAACGCTATATTTTGAAGGCTTTAAGAAAAATAGAGCAAAATGGCCCTTGA |
| Sequence | LMKTTENTDETHLRETKNKLGRKPKTDANKKTRAVSLYFSDEQYQKLEKMANEEEESVGSYIKRYILKALRKIEQNGP |
| Source of smORF | Protein-level |
| Function | The ORF matches to the profile of pfam16777. Profile Description: Transcriptional regulator, RHH-like, CopG. RHH_7 is a ribbon-helix-helix protein family expressed by Helicobacter species. These proteins bind to specific DNA sequences with high affinity and usually act as repressors. Many are putatively named CopG. |
| Pubmed ID | 30796087 |
| Domain | CDD:374794 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | |
| ORF Length (Amino Acid) | 78 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 220434 | 220670 | + | NC_017379.1 | Helicobacter pylori Puno135 |
| 2 | 1746354 | 1746590 | + | NC_017735.1 | Helicobacter cetorum MIT 99-5656 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017379.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01161.22 | 1.0 | 2 | 3118.0 | opposite-strand | Phosphatidylethanolamine-binding protein |
| 2 | PF00266.21 | 1.0 | 2 | 1166.5 | same-strand | Aminotransferase class-V |
| 3 | PF01592.18 | 1.0 | 2 | 163.5 | same-strand | NifU-like N terminal domain |
| 4 | PF01106.19 | 1.0 | 2 | 163.5 | same-strand | NifU-like domain |
| 5 | PF04324.17 | 1.0 | 2 | 163.5 | same-strand | BFD-like [2Fe-2S] binding domain |
| 6 | PF18073.3 | 1.0 | 2 | 109.0 | same-strand | Rubredoxin metal binding domain |
| 7 | PF13481.8 | 1.0 | 2 | 109.0 | same-strand | AAA domain |
| 8 | PF01625.23 | 1.0 | 2 | 1615.0 | same-strand | Peptide methionine sulfoxide reductase |
| 9 | PF01641.20 | 1.0 | 2 | 1615.0 | same-strand | SelR domain |
++ More..