Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01245 |
NCBI Accession ID | NC_017381.1 |
Organism | Helicobacter pylori 2018 |
Left | 224629 |
Right | 224865 |
Strand | + |
Nucleotide Sequence | TTGATGAAAACGACAGAAAACACAGATGAAACTCACTTAAGGGAAACTAAAAATAAACTAGGACGCAAACCAAAAACAGACGCTAATAAAAAAACTCGCGCGGTAAGCTTGTATTTTTCTGATGAGCAATACCAAAAACTAGAGAAAATGGCTAACGAAGAAGAAGAAAGCGTGGGATCTTATATCAAACGCTATATTTTGAAGGCTTTAAGAAAAATAGAGCAAAATGGCCCTTGA |
Sequence | LMKTTENTDETHLRETKNKLGRKPKTDANKKTRAVSLYFSDEQYQKLEKMANEEEESVGSYIKRYILKALRKIEQNGP |
Source of smORF | Protein-level |
Function | The ORF matches to the profile of pfam16777. Profile Description: Transcriptional regulator, RHH-like, CopG. RHH_7 is a ribbon-helix-helix protein family expressed by Helicobacter species. These proteins bind to specific DNA sequences with high affinity and usually act as repressors. Many are putatively named CopG. |
Pubmed ID | 30796087 |
Domain | CDD:374794 |
Functional Category | Conserved domain based functional assignment |
Uniprot ID | |
ORF Length (Amino Acid) | 78 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 220434 | 220670 | + | NC_017379.1 | Helicobacter pylori Puno135 |
2 | 1746354 | 1746590 | + | NC_017735.1 | Helicobacter cetorum MIT 99-5656 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01161.22 | 1.0 | 2 | 3118.0 | opposite-strand | Phosphatidylethanolamine-binding protein |
2 | PF00266.21 | 1.0 | 2 | 1166.5 | same-strand | Aminotransferase class-V |
3 | PF01592.18 | 1.0 | 2 | 163.5 | same-strand | NifU-like N terminal domain |
4 | PF01106.19 | 1.0 | 2 | 163.5 | same-strand | NifU-like domain |
5 | PF04324.17 | 1.0 | 2 | 163.5 | same-strand | BFD-like [2Fe-2S] binding domain |
6 | PF18073.3 | 1.0 | 2 | 109.0 | same-strand | Rubredoxin metal binding domain |
7 | PF13481.8 | 1.0 | 2 | 109.0 | same-strand | AAA domain |
8 | PF01625.23 | 1.0 | 2 | 1615.0 | same-strand | Peptide methionine sulfoxide reductase |
9 | PF01641.20 | 1.0 | 2 | 1615.0 | same-strand | SelR domain |