Result : EXP01208
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01208 |
| NCBI Accession ID | NC_017340.1 |
| Organism | Staphylococcus aureus 04-02981 |
| Left | 1977889 |
| Right | 1978164 |
| Strand | + |
| Nucleotide Sequence | ATGGAAAATAAATTTGTTCCTGGTATTTTAATTGGTGCCGTAATTGGTGGTGCAATTAGTTTAGCTGATAAATCTACACGTCAAGCTTTAGTTCAATCAGTTAAAGATGCAAAAAATGGTAACCGCACTCGTAAGCCTTCTAAAGTCAGCAAGATTAAAGACGAAGTTTTATACTGGAAAGATGTTGTTGAAGAAATTCGTCGTAATAATCCTGAATTAGAACGTTCATTAAAGGATGCGAAAGAAACATTTGTTAATAGAAAAAATCAACGCTAA |
| Sequence | MENKFVPGILIGAVIGGAISLADKSTRQALVQSVKDAKNGNRTRKPSKVSKIKDEVLYWKDVVEEIRRNNPELERSLKDAKETFVNRKNQR |
| Source of smORF | Protein-level |
| Function | The ORF matches to the profile of cl02079. Profile Description: YtxH-like protein. This family of proteins is found in bacteria. Proteins in this family are typically between 100 and 143 amino acids in length. The N-terminal region is the most conserved. Proteins is this family are functionally uncharacterized. |
| Pubmed ID | 30796087 |
| Domain | CDD:413184 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | |
| ORF Length (Amino Acid) | 91 |
++ More..
| Conservation Analysis |
No. of Species: 32
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1971076 | 1971351 | + | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 2 | 1971421 | 1971696 | + | NZ_LR134304.1 | Staphylococcus schweitzeri |
| 3 | 1888891 | 1889166 | + | NZ_LT906460.1 | Staphylococcus simiae |
| 4 | 999710 | 999994 | - | NZ_CP035288.1 | Staphylococcus epidermidis |
| 5 | 1536379 | 1536663 | + | NZ_CP013911.1 | Staphylococcus haemolyticus |
| 6 | 183745 | 184029 | - | NZ_CP018199.1 | Staphylococcus succinus |
| 7 | 2519084 | 2519368 | - | NZ_CP014022.1 | Staphylococcus lugdunensis |
| 8 | 966029 | 966313 | - | NZ_LR134242.1 | Staphylococcus warneri |
| 9 | 462488 | 462772 | + | NC_022737.1 | Staphylococcus pasteuri SP1 |
| 10 | 1742410 | 1742694 | + | NZ_CP013114.1 | Staphylococcus equorum |
| 11 | 970689 | 970973 | - | NZ_LR134089.1 | Staphylococcus saprophyticus |
| 12 | 995701 | 995982 | - | NZ_CP064056.1 | Staphylococcus lloydii |
| 13 | 1035784 | 1036068 | - | NZ_CP008724.1 | Staphylococcus xylosus |
| 14 | 841246 | 841530 | - | NZ_CP065712.1 | Staphylococcus auricularis |
| 15 | 2323051 | 2323335 | + | NZ_CP066042.1 | Staphylococcus saccharolyticus |
| 16 | 1189141 | 1189425 | + | NZ_CP007601.1 | Staphylococcus capitis subsp. capitis |
| 17 | 1058371 | 1058655 | - | NZ_AP018587.1 | Staphylococcus caprae |
| 18 | 809539 | 809838 | - | NZ_LT906462.1 | Mammaliicoccus stepanovicii |
| 19 | 1731768 | 1732049 | - | NZ_CP033732.1 | Staphylococcus hominis |
| 20 | 1473600 | 1473890 | + | NZ_LT906464.1 | Staphylococcus muscae |
| 21 | 724103 | 724402 | - | NZ_CP022046.2 | Mammaliicoccus sciuri |
| 22 | 1931378 | 1931668 | + | NZ_CP033460.1 | Staphylococcus debuckii |
| 23 | 803948 | 804250 | + | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 24 | 1425771 | 1426070 | + | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 25 | 1699076 | 1699363 | + | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 26 | 1534600 | 1534875 | + | NZ_CP045927.1 | Staphylococcus agnetis |
| 27 | 2378806 | 2379093 | + | NZ_CP027770.1 | Staphylococcus felis |
| 28 | 939583 | 939858 | - | NZ_CP008747.1 | Staphylococcus hyicus |
| 29 | 1164348 | 1164644 | - | NZ_CP018776.1 | Staphylococcus condimenti |
| 30 | 356473 | 356760 | + | NZ_CP020773.1 | Staphylococcus lutrae |
| 31 | 1332741 | 1333046 | + | NZ_CP065729.1 | Macrococcus caseolyticus |
| 32 | 1850372 | 1850677 | + | NZ_CP047361.1 | Macrococcus canis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_007795.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08756.12 | 0.78 | 25 | 2805 | same-strand | YfkB-like domain |
| 2 | PF04055.23 | 0.69 | 22 | 2797.5 | same-strand | Radical SAM superfamily |
| 3 | PF13394.8 | 0.78 | 25 | 2805 | same-strand | 4Fe-4S single cluster domain |
| 4 | PF03061.24 | 1.0 | 32 | 2149.0 | opposite-strand | Thioesterase superfamily |
| 5 | PF02073.17 | 1.0 | 32 | 830.0 | opposite-strand | Thermophilic metalloprotease (M29) |
| 6 | PF06569.13 | 1.0 | 32 | 612.0 | opposite-strand | Protein of unknown function (DUF1128) |
| 7 | PF01451.23 | 0.84 | 27 | 7 | same-strand | Low molecular weight phosphotyrosine protein phosphatase |
| 8 | PF03631.17 | 1.0 | 32 | 222.5 | same-strand | Virulence factor BrkB |
| 9 | PF00072.26 | 1.0 | 32 | 1706.0 | opposite-strand | Response regulator receiver domain |
| 10 | PF00196.21 | 1.0 | 32 | 1706.0 | opposite-strand | Bacterial regulatory proteins, luxR family |
| 11 | PF08281.14 | 1.0 | 32 | 1706.0 | opposite-strand | Sigma-70, region 4 |
| 12 | PF07730.15 | 1.0 | 32 | 2327.0 | opposite-strand | Histidine kinase |
| 13 | PF02518.28 | 1.0 | 32 | 2327.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 14 | PF09922.11 | 1.0 | 32 | 3366.5 | opposite-strand | Cell wall-active antibiotics response 4TMS YvqF |
++ More..