| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01191 |
| NCBI Accession ID | ABAX03000003.1 |
| Organism | Anaerostipes caccae (strain DSM 14662 / NCIMB 13811 / L1-92) |
| Left | 66663 |
| Right | 66953 |
| Strand | - |
| Nucleotide Sequence | ATGAGAGAGACTTCTTTACTGCTGGCCGGAGGCATGAAGAAAGAAAAAGCCCAAAAGGCGGCAGAGCTTCTGAAAGAAGGACTGAAAGAAAAGAACATAATGGCCGAGGTGACATTTGTAAATACATATGAGGTGACGGACTTAAAAAGTCTGGAAGAAGGCCATGATATGGTGATCTCTACTGCTACAGGCAATCTGAATACATCGCTTCCGGTACTGCAGGGATTGTGTCTTTTATATCCATGGATGGGGACCGGGAAACTGTATGAGGAAGTAGAAAAGAATCTTTAA |
| Sequence | MRETSLLLAGGMKKEKAQKAAELLKEGLKEKNIMAEVTFVNTYEVTDLKSLEEGHDMVISTATGNLNTSLPVLQGLCLLYPWMGTGKLYEEVEKNL |
| Source of smORF | Protein-level |
| Function | The ORF matches to the profile of cl10014. Profile Description: N/A. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. The lactose/cellobiose-specific family are one of four structurally and functionally distinct group IIB PTS system cytoplasmic enzymes. The fold of IIB cellobiose shows similar structure to mammalian tyrosine phosphatases. This family also contains the fructose specific IIB subunit. |
| Pubmed ID | 31841667 |
| Domain | CDD:415825 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | |
| ORF Length (Amino Acid) | 96 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2472339 | 2472629 | - | NZ_CP036345.1 | Anaerostipes caccae L1-92 |
| 2 | 1071053 | 1071352 | + | NZ_CP040058.1 | Anaerostipes rhamnosivorans |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00239.23 | 1.0 | 2 | 2889.0 | same-strand | Resolvase, N terminal domain |
| 2 | PF01937.21 | 1.0 | 2 | 1975.0 | same-strand | Damage-control phosphatase ARMT1-like domain |
| 3 | PF13685.8 | 1.0 | 2 | 677.5 | same-strand | Iron-containing alcohol dehydrogenase |
| 4 | PF00359.24 | 1.0 | 2 | 19.0 | same-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
| 5 | PF03611.16 | 1.0 | 2 | 709.5 | same-strand | PTS system sugar-specific permease component |
| 6 | PF00248.23 | 1.0 | 2 | 1987.0 | same-strand | Aldo/keto reductase family |
| 7 | PF02302.19 | 1.0 | 2 | 2903.0 | same-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
| 8 | PF04198.15 | 1.0 | 2 | 3256.0 | same-strand | Putative sugar-binding domain |
| 9 | PF12802.9 | 1.0 | 2 | 3256.0 | same-strand | MarR family |