Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01144 |
NCBI Accession ID | AE015928.1 |
Organism | Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / NCTC 10582 / E50 / VPI-5482) |
Left | 778097 |
Right | 778297 |
Strand | + |
Nucleotide Sequence | ATGTTGAAAGAAAAAGCAGGTGTAATCGCAGGTAATATCTGGAATGCACTGAATGAAACAGAAGGAATGACTGCCAAGCAACTGAAAAAAGCAACTAAATTGGTTGACAAAGATTTGTTCCTCGGCCTTGGCTGGTTATTGAGAGAAGATAAAGTTTCTGCTGAAGAAGTAGAAGGTGAACTCTTCATCAAATTGATCTAA |
Sequence | MLKEKAGVIAGNIWNALNETEGMTAKQLKKATKLVDKDLFLGLGWLLREDKVSAEEVEGELFIKLI |
Source of smORF | Protein-level |
Function | The ORF matches to the profile of pfam10771. Profile Description: Winged helix-turn-helix domain (DUF2582). This family is conserved in bacteria and archaea. The function is not known. The structure of two proteins in this family were solved using NMR and shown to adopt a winged helix-turn-helix fold. Structural analysis shows that these proteins form an unusual dimeric conformation. This dimer was shown to be similar to that found in the FadR and TubR wHTH domains. It was suggested that these proteins are not very likely to bind to DNA. |
Pubmed ID | 31841667 |
Domain | CDD:402413 |
Functional Category | Conserved domain based functional assignment |
Uniprot ID | |
ORF Length (Amino Acid) | 66 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4356194 | 4356394 | + | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
2 | 1299484 | 1299684 | - | NZ_CP012938.1 | Bacteroides ovatus |
3 | 2309681 | 2309881 | - | NZ_CP015401.2 | Bacteroides caecimuris |
4 | 3103520 | 3103720 | - | NC_014933.1 | Bacteroides helcogenes P 36-108 |
5 | 2931141 | 2931341 | - | NZ_LN877293.1 | Bacteroides fragilis |
6 | 613047 | 613247 | - | NZ_CP027231.1 | Bacteroides zoogleoformans |
7 | 1994963 | 1995163 | - | NZ_CP069440.1 | Phocaeicola coprophilus |
8 | 1125622 | 1125822 | - | NZ_CP027234.1 | Bacteroides heparinolyticus |
9 | 4818980 | 4819183 | - | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
10 | 5117103 | 5117306 | - | NZ_LR699004.1 | Phocaeicola dorei |
11 | 1718216 | 1718422 | - | NC_015164.1 | Phocaeicola salanitronis DSM 18170 |
12 | 2241549 | 2241749 | + | NZ_CP007034.1 | Barnesiella viscericola DSM 18177 |
13 | 1384717 | 1384896 | - | NZ_LR215980.1 | Paraprevotella xylaniphila YIT 11841 |
14 | 4129524 | 4129721 | + | NZ_LT605205.1 | Proteiniphilum saccharofermentans |
15 | 2618696 | 2618893 | - | NC_014734.1 | Paludibacter propionicigenes WB4 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF09719.12 | 0.8 | 12 | 156.5 | same-strand | Putative redox-active protein (C GCAxxG C C) |
2 | PF00009.29 | 0.67 | 10 | 129.0 | same-strand | Elongation factor Tu GTP binding domain |
3 | PF06421.14 | 0.67 | 10 | 129.0 | same-strand | GTP-binding protein LepA C-terminus |
4 | PF00679.26 | 0.67 | 10 | 129.0 | same-strand | Elongation factor G C-terminus |
5 | PF03144.27 | 0.67 | 10 | 129.0 | same-strand | Elongation factor Tu domain 2 |
6 | PF00071.24 | 0.67 | 10 | 129.0 | same-strand | Ras family |
7 | PF14492.8 | 0.6 | 9 | 129 | same-strand | Elongation Factor G, domain III |
8 | PF01926.25 | 0.67 | 10 | 129.0 | same-strand | 50S ribosome-binding GTPase |