Result : EXP01126
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01126 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3374630 |
| Right | 3374806 |
| Strand | - |
| Nucleotide Sequence | ATGTTTATTGCCTGGTATTGGATAATATTAATCGTTCTGGTGGTAGTAGGGTATATTTGCCATATGAAGCGTTATTGCAGAGCGTTTCGGCAAGACAGAGATGCATTACTTGAAGCGCGAACGAAACGTTTTCGCCAGACGAGCGAAGGCGACAGCGTGATGAATGAGCAGAAATAG |
| Sequence | MFIAWYWIILIVLVVVGYICHMKRYCRAFRQDRDALLEARTKRFRQTSEGDSVMNEQK |
| Source of smORF | Protein-level |
| Function | integral component of membrane [GO:0016021]; plasma membrane [GO:0005886];INDUCTION: Expressed approximately equally in exponential and stationary phases (at protein level) Pubmed:29645342 The ORF matches to the profile of pfam13260. Profile Description: Protein of unknown function (DUF4051). This family of proteins is functionally uncharacterized. This family of proteins is found in bacteria. Proteins in this family are approximately 60 amino acids in length. |
| Pubmed ID | Venturini et al 2020 |
| Domain | CDD:372537 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DPP7 |
| ORF Length (Amino Acid) | 58 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3353933 | 3354109 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1206874 | 1207050 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 1968992 | 1969168 | - | NZ_CP033744.1 | Citrobacter freundii |
| 4 | 3127117 | 3127293 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 5 | 4131433 | 4131609 | + | NZ_CP038469.1 | Citrobacter tructae |
| 6 | 3778098 | 3778274 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 4105571 | 4105747 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 8 | 644739 | 644906 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 9 | 3709808 | 3709978 | - | NZ_LR134340.1 | Escherichia marmotae |
| 10 | 3176516 | 3176686 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 11 | 3183381 | 3183551 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 12 | 3175599 | 3175769 | - | NZ_AP014857.1 | Escherichia albertii |
| 13 | 2079069 | 2079236 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 14 | 1962855 | 1963031 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 15 | 5145881 | 5146057 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 16 | 3929603 | 3929773 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP053416.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02321.20 | 0.73 | 11 | 3806.5 | opposite-strand | Outer membrane efflux protein |
| 2 | PF06693.13 | 0.73 | 11 | 2970.5 | opposite-strand | Protein of unknown function (DUF1190) |
| 3 | PF03738.16 | 0.73 | 11 | 1804.5 | opposite-strand | Glutathionylspermidine synthase preATP-grasp |
| 4 | PF02900.20 | 0.93 | 14 | 947 | same-strand | Catalytic LigB subunit of aromatic ring-opening dioxygenase |
| 5 | PF17425.4 | 0.6 | 9 | 400 | opposite-strand | Arylsulfotransferase Ig-like domain |
| 6 | PF01323.22 | 0.6 | 9 | 2218 | opposite-strand | DSBA-like thioredoxin domain |
| 7 | PF13462.8 | 0.6 | 9 | 2218 | opposite-strand | Thioredoxin |
| 8 | PF02600.18 | 0.6 | 9 | 2899 | opposite-strand | Disulfide bond formation protein DsbB |
| 9 | PF00926.21 | 0.87 | 13 | 1973.0 | same-strand | 3,4-dihydroxy-2-butanone 4-phosphate synthase |
| 10 | PF04380.15 | 0.67 | 10 | 1291 | opposite-strand | Membrane fusogenic activity |
++ More..