Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01118 |
NCBI Accession ID | NC_016810.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
Left | 4837121 |
Right | 4837174 |
Strand | + |
Nucleotide Sequence | ATGTGCACCACACTAAAAATATCGCGAATGAGTAGCCTGAGCGCTCATATTTAG |
Sequence | MCTTLKISRMSSLSAHI |
Source of smORF | Protein-level |
Function | |
Pubmed ID | Venturini et al 2020 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 17 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4816556 | 4816609 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 2571933 | 2571986 | + | NZ_CP053416.1 | Salmonella bongori |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03603.15 | 1.0 | 2 | 3844.0 | same-strand | DNA polymerase III psi subunit |
2 | PF00702.28 | 1.0 | 2 | 2741.5 | same-strand | haloacid dehalogenase-like hydrolase |
3 | PF13242.8 | 1.0 | 2 | 2741.5 | same-strand | HAD-hyrolase-like |
4 | PF16658.7 | 1.0 | 2 | 1061.0 | same-strand | Class II release factor RF3, C-terminal domain |
5 | PF00009.29 | 1.0 | 2 | 1061.0 | same-strand | Elongation factor Tu GTP binding domain |
6 | PF03144.27 | 1.0 | 2 | 1061.0 | same-strand | Elongation factor Tu domain 2 |
7 | PF01926.25 | 1.0 | 2 | 1061.0 | same-strand | 50S ribosome-binding GTPase |
8 | PF14492.8 | 1.0 | 2 | 1061.0 | same-strand | Elongation Factor G, domain III |
9 | PF04972.19 | 1.0 | 2 | 42.0 | same-strand | BON domain |
10 | PF07043.15 | 1.0 | 2 | 34.0 | same-strand | Protein of unknown function (DUF1328) |
11 | PF19890.1 | 1.0 | 2 | 308.0 | same-strand | Domain of unknown function (DUF6363) |
12 | PF01734.24 | 1.0 | 2 | 308.0 | same-strand | Patatin-like phospholipase |
13 | PF01026.23 | 1.0 | 2 | 1388.5 | same-strand | TatD related DNase |
14 | PF04055.23 | 1.0 | 2 | 2194.5 | opposite-strand | Radical SAM superfamily |
15 | PF11230.10 | 1.0 | 2 | 3029.5 | opposite-strand | Protein of unknown function (DUF3029) |