Result : EXP01106
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01106 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3032939 |
| Right | 3033010 |
| Strand | - |
| Nucleotide Sequence | ATGATTAACCAAGTGAGCGTTTATCGACAACCGCCCGTTTTGAGCGGATGCCGACAGGTAAAAACCATTTAA |
| Sequence | MINQVSVYRQPPVLSGCRQVKTI |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed during stationary phase (at protein level) Pubmed:29645342 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DPP4 |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3771216 | 3771287 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3032939 | 3033010 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 647016 | 647087 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 2966854 | 2966925 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00860.22 | 0.67 | 2 | 124 | opposite-strand | Permease family |
| 2 | PF00293.30 | 1.0 | 3 | 55.0 | opposite-strand | NUDIX domain |
| 3 | PF00152.22 | 1.0 | 3 | 646.0 | same-strand | tRNA synthetases class II (D, K and N) |
| 4 | PF01336.27 | 1.0 | 3 | 646.0 | same-strand | OB-fold nucleic acid binding domain |
| 5 | PF00472.22 | 1.0 | 3 | 2173.0 | same-strand | RF-1 domain |
| 6 | PF02272.21 | 1.0 | 3 | 3362.0 | same-strand | DHHA1 domain |
| 7 | PF01368.22 | 1.0 | 3 | 3362.0 | same-strand | DHH family |
| 8 | PF17768.3 | 1.0 | 3 | 3362.0 | same-strand | RecJ OB domain |
| 9 | PF13098.8 | 1.0 | 3 | 5101.0 | same-strand | Thioredoxin-like domain |
| 10 | PF10411.11 | 1.0 | 3 | 5101.0 | same-strand | Disulfide bond isomerase protein N-terminus |
| 11 | PF00665.28 | 0.67 | 2 | 1825.0 | same-strand | Integrase core domain |
| 12 | PF13683.8 | 0.67 | 2 | 1825.0 | same-strand | Integrase core domain |
| 13 | PF01527.22 | 0.67 | 2 | 1494.5 | same-strand | Transposase |
++ More..