| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01089 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 294918 |
| Right | 295142 |
| Strand | - |
| Nucleotide Sequence | ATGAGCGCATTCAAACTCCCGGATACATCTCAATCACAGCTCATTTCAACAGCTGAGTTAGCTAAAATCATTAGCTACAAATCTCAAACCATTCGTAAATGGCTTTGTCAGGACAAATTGCCTGAGGGGCTACCTCGCCCAAAACAAATCAATGGCCGCCATTACTGGTTACGTAAAGATGTCCTCGATTTTATAGATACATTTTCTGTACGAGAAAGTCTGTAA |
| Sequence | MSAFKLPDTSQSQLISTAELAKIISYKSQTIRKWLCQDKLPEGLPRPKQINGRHYWLRKDVLDFIDTFSVRESL |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed at low, approximately equal levels in exponential and stationary phases (at protein level) Pubmed:29645342 The ORF matches to the profile of cl02600. Profile Description: Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily. This domain is a DNA-binding helix-turn-helix domain. |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | CDD:413393 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DPM9 |
| ORF Length (Amino Acid) | 74 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 294918 | 295142 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1166120 | 1166341 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 3 | 3191136 | 3191357 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF11726.10 | 1.0 | 3 | 1363 | same-strand | Inovirus Gp2 |
| 2 | PF00589.24 | 1.0 | 3 | 554 | same-strand | Phage integrase family |