Result : EXP01089

Protein Information

• Protein name: EXP01089
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 294918
• Right: 295142
• Strand: -
• Nucleotide Sequence: ATGAGCGCATTCAAACTCCCGGATACATCTCAATCACAGCTCATTTCAACAGCTGAGTTAGCTAAAATCATTAGCTACAAATCTCAAACCATTCGTAAATGGCTTTGTCAGGACAAATTGCCTGAGGGGCTACCTCGCCCAAAACAAATCAATGGCCGCCATTACTGGTTACGTAAAGATGTCCTCGATTTTATAGATACATTTTCTGTACGAGAAAGTCTGTAA
• Sequence: MSAFKLPDTSQSQLISTAELAKIISYKSQTIRKWLCQDKLPEGLPRPKQINGRHYWLRKDVLDFIDTFSVRESL
• Source of smORF: Protein-level
• Function: INDUCTION: Expressed at low, approximately equal levels in exponential and stationary phases (at protein level) Pubmed:29645342; The ORF matches to the profile of cl02600. Profile Description: Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily. This domain is a DNA-binding helix-turn-helix domain.
• Pubmed ID: 19121005 29645342 30837344
• Domain: CDD:413393
• Functional Category: Gene Ontology/Expression based functional assignment
• Uniprot ID: P0DPM9
• ORF Length (Amino Acid): 74

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	294918	295142	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	1166120	1166341	-	NZ_CP043318.1	Enterobacter chengduensis
3	3191136	3191357	+	NZ_CP013940.1	Cronobacter malonaticus LMG 23826

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF11726.10	1.0	3	1363	same-strand	Inovirus Gp2
2	PF00589.24	1.0	3	554	same-strand	Phage integrase family