Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01087 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 1946115 |
Right | 1946180 |
Strand | - |
Nucleotide Sequence | ATGTATATTTTTATTACGCATTTCTTCACTGAATATGTAATATTAAAATATTTGCTTCCAATATAA |
Sequence | MYIFITHFFTEYVILKYLLPI |
Source of smORF | Protein-level |
Function | INDUCTION: In stationary phase, induced at 45 degrees Celsius (at protein level) Pubmed:19121005,19734316 |
Pubmed ID | 19121005 29645342 30837344 |
Domain | |
Functional Category | Gene Ontology/Expression based functional assignment |
Uniprot ID | C1P604 |
ORF Length (Amino Acid) | 21 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2548182 | 2548247 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 1946115 | 1946180 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 2517763 | 2517828 | - | NZ_CP061527.1 | Shigella dysenteriae |
4 | 1909987 | 1910052 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01297.19 | 1.0 | 3 | 3497.5 | same-strand | Zinc-uptake complex component A periplasmic |
2 | PF00005.29 | 1.0 | 3 | 2698.0 | opposite-strand | ABC transporter |
3 | PF00950.19 | 1.0 | 3 | 1916.0 | opposite-strand | ABC 3 transport family |
4 | PF05496.14 | 1.0 | 3 | 759.0 | same-strand | Holliday junction DNA helicase RuvB P-loop domain |
5 | PF17864.3 | 1.0 | 3 | 759.0 | same-strand | RuvB AAA lid domain |
6 | PF05491.15 | 1.0 | 3 | 759.0 | same-strand | RuvB C-terminal winged helix domain |
7 | PF00004.31 | 1.0 | 3 | 759.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
8 | PF01330.23 | 1.0 | 3 | 139.0 | same-strand | RuvA N terminal domain |
9 | PF14520.8 | 1.0 | 3 | 139.0 | same-strand | Helix-hairpin-helix domain |
10 | PF07499.15 | 1.0 | 3 | 139.0 | same-strand | RuvA, C-terminal domain |
11 | PF05708.14 | 1.0 | 3 | 71.0 | opposite-strand | Permuted papain-like amidase enzyme, YaeF/YiiX, C92 family |
12 | PF02075.19 | 1.0 | 3 | 675.0 | same-strand | Crossover junction endodeoxyribonuclease RuvC |
13 | PF01709.22 | 0.67 | 2 | 1231 | same-strand | Transcriptional regulator |
14 | PF00293.30 | 0.67 | 2 | 2000 | same-strand | NUDIX domain |
15 | PF00152.22 | 0.67 | 2 | 2570 | same-strand | tRNA synthetases class II (D, K and N) |
16 | PF02938.16 | 0.67 | 2 | 2570 | same-strand | GAD domain |
17 | PF01336.27 | 0.67 | 2 | 2570 | same-strand | OB-fold nucleic acid binding domain |