Result : EXP01080
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01080 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1642122 |
| Right | 1642211 |
| Strand | + |
| Nucleotide Sequence | ATGAATAACCCCGTCTGTCTTGATGACTGGTTGATTGGCTTTAAAAGCTTATGCTGTACTTTGGCCGTAATAGCTCTGCTAATAATATAA |
| Sequence | MNNPVCLDDWLIGFKSLCCTLAVIALLII |
| Source of smORF | Protein-level |
| Function | integral component of membrane [GO:0016021]; plasma membrane [GO:0005886];INDUCTION: Expressed in both exponential and stationary phase; expression is considerably higher during stationary phase (at protein level) Pubmed:29645342 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DPP0 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1642122 | 1642211 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 610269 | 610358 | + | NZ_CP033744.1 | Citrobacter freundii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00313.24 | 1.0 | 2 | 568 | opposite-strand | 'Cold-shock' DNA-binding domain |
++ More..