| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01076 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 850332 |
| Right | 850397 |
| Strand | + |
| Nucleotide Sequence | ATGGAAACGTTCTGTTACATGAAATGGCCCGTTAGACATCACAAATCGCGAAGAGTTTCCCATTAA |
| Sequence | METFCYMKWPVRHHKSRRVSH |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase; expression is considerably higher in exponential phase (at protein level) Pubmed:29645342 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DPN6 |
| ORF Length (Amino Acid) | 21 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 974639 | 974704 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 850332 | 850397 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 794394 | 794459 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2884274 | 2884339 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1494709 | 1494774 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 899419 | 899484 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 7 | 3378448 | 3378513 | + | NZ_CP053416.1 | Salmonella bongori |
| 8 | 4138559 | 4138615 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 9 | 1565542 | 1565604 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 10 | 2901335 | 2901391 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 11 | 1538024 | 1538089 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 12 | 3149727 | 3149789 | - | NZ_CP045845.1 | Kluyvera intermedia |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 0.91 | 10 | 3856 | opposite-strand | ABC transporter |
| 2 | PF00528.24 | 1.0 | 11 | 3206.0 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 3 | PF00497.22 | 1.0 | 11 | 2327.5 | opposite-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 4 | PF00210.26 | 1.0 | 11 | 1421.0 | opposite-strand | Ferritin-like domain |
| 5 | PF00892.22 | 1.0 | 11 | 236.0 | opposite-strand | EamA-like transporter family |
| 6 | PF13505.8 | 1.0 | 11 | 53.0 | same-strand | Outer membrane protein beta-barrel domain |
| 7 | PF00884.25 | 1.0 | 11 | 630.5 | opposite-strand | Sulfatase |
| 8 | PF01325.21 | 1.0 | 11 | 2789.0 | same-strand | Iron dependent repressor, N-terminal DNA binding domain |
| 9 | PF03600.18 | 0.82 | 9 | 3259.0 | same-strand | Citrate transporter |