Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01070 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 3884026 |
Right | 3884106 |
Strand | + |
Nucleotide Sequence | ATGACCATAGACAAAAATTGGCTTAATCGATCTAATAAAGATCCAGGACGATCCTTGCGCTTTACCCATCAGCCCGTATAA |
Sequence | MTIDKNWLNRSNKDPGRSLRFTHQPV |
Source of smORF | Protein-level |
Function | INDUCTION: Expressed during stationary phase (at protein level) Pubmed:29645342 |
Pubmed ID | 19121005 29645342 30837344 |
Domain | |
Functional Category | Gene Ontology/Expression based functional assignment |
Uniprot ID | P0DPP8 |
ORF Length (Amino Acid) | 26 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4670384 | 4670464 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 3884026 | 3884106 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 3868652 | 3868732 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 4072754 | 4072834 | - | NZ_CP061527.1 | Shigella dysenteriae |
5 | 3858624 | 3858704 | + | NZ_AP014857.1 | Escherichia albertii |
6 | 2889843 | 2889923 | - | NZ_CP057657.1 | Escherichia fergusonii |
7 | 2665991 | 2666071 | + | NZ_CP033744.1 | Citrobacter freundii |
8 | 2418963 | 2419043 | - | NZ_CP044098.1 | Citrobacter portucalensis |
9 | 3428502 | 3428582 | - | NZ_CP038469.1 | Citrobacter tructae |
10 | 49373 | 49453 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
11 | 1366290 | 1366370 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
12 | 4616265 | 4616345 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
13 | 6183206 | 6183286 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
14 | 4002190 | 4002270 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
15 | 51011 | 51091 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
16 | 455868 | 455948 | + | NZ_CP045205.1 | Citrobacter telavivensis |
17 | 48177 | 48257 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
18 | 1733720 | 1733800 | - | NZ_CP042941.1 | Atlantibacter hermannii |
19 | 5314454 | 5314534 | + | NZ_CP015113.1 | Kosakonia radicincitans |
20 | 5415785 | 5415865 | - | NZ_CP014007.2 | Kosakonia oryzae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00204.27 | 0.89 | 17 | 3989.0 | opposite-strand | DNA gyrase B |
2 | PF18053.3 | 0.89 | 17 | 3989.0 | opposite-strand | DNA gyrase B subunit insert domain |
3 | PF00986.23 | 0.89 | 17 | 3989.0 | opposite-strand | DNA gyrase B subunit, carboxyl terminus |
4 | PF02518.28 | 0.89 | 17 | 3989.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
5 | PF01751.24 | 0.89 | 17 | 3989.0 | opposite-strand | Toprim domain |
6 | PF02463.21 | 0.89 | 17 | 2887.0 | opposite-strand | RecF/RecN/SMC N terminal domain |
7 | PF02767.18 | 0.89 | 17 | 1705.0 | opposite-strand | DNA polymerase III beta subunit, central domain |
8 | PF00712.21 | 0.89 | 17 | 1705.0 | opposite-strand | DNA polymerase III beta subunit, N-terminal domain |
9 | PF02768.17 | 0.89 | 17 | 1705.0 | opposite-strand | DNA polymerase III beta subunit, C-terminal domain |
10 | PF00308.20 | 0.89 | 17 | 298.0 | opposite-strand | Bacterial dnaA protein |
11 | PF08299.13 | 0.84 | 16 | 298 | opposite-strand | Bacterial dnaA protein helix-turn-helix |
12 | PF11638.10 | 0.89 | 17 | 298.0 | opposite-strand | DnaA N-terminal domain |
13 | PF00004.31 | 0.84 | 16 | 298 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
14 | PF00825.20 | 0.95 | 18 | 420 | same-strand | Ribonuclease P |
15 | PF14849.8 | 1.0 | 19 | 970.0 | same-strand | YidC periplasmic domain |
16 | PF02096.22 | 1.0 | 19 | 970.0 | same-strand | 60Kd inner membrane protein |
17 | PF12631.9 | 1.0 | 19 | 2722.0 | same-strand | MnmE helical domain |
18 | PF10396.11 | 1.0 | 19 | 2722.0 | same-strand | GTP-binding protein TrmE N-terminus |
19 | PF01926.25 | 0.79 | 15 | 2722.0 | same-strand | 50S ribosome-binding GTPase |