Result : EXP01066
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01066 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1671777 |
| Right | 1671860 |
| Strand | + |
| Nucleotide Sequence | ATGGTGGGCCGTTATCGCTTTGAGTTCATTCTGATCATCCTTATTTTATGCGCACTGATTACCGCCCGTTTTTATCTTTCCTGA |
| Sequence | MVGRYRFEFILIILILCALITARFYLS |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed during stationary phase (at protein level) Pubmed:19121005 The ORF matches to the profile of PRK14758. Profile Description: hypothetical protein; Provisional |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | CDD:173219 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | A5A617 |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 83
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1671777 | 1671860 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2271715 | 2271798 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1615225 | 1615308 | + | NZ_AP014857.1 | Escherichia albertii |
| 4 | 1646415 | 1646498 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 2137020 | 2137103 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 2181774 | 2181857 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 3708733 | 3708816 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 8 | 3279399 | 3279482 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 9 | 997210 | 997293 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 10 | 867300 | 867383 | - | NZ_CP038469.1 | Citrobacter tructae |
| 11 | 51719 | 51802 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 12 | 3958765 | 3958845 | - | NZ_CP053416.1 | Salmonella bongori |
| 13 | 104937 | 105020 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 14 | 1561882 | 1561962 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 15 | 469792 | 469872 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 16 | 1381136 | 1381219 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 17 | 29768 | 29851 | - | NZ_CP033744.1 | Citrobacter freundii |
| 18 | 2530823 | 2530906 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 19 | 1643995 | 1644078 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 20 | 2922813 | 2922896 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 21 | 2181440 | 2181520 | - | NZ_CP006569.1 | Sodalis praecaptivus |
| 22 | 2234459 | 2234542 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 23 | 2932442 | 2932525 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 24 | 860731 | 860814 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 25 | 1550090 | 1550170 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 26 | 2594704 | 2594787 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 27 | 884679 | 884762 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 28 | 2241855 | 2241938 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 29 | 2277762 | 2277842 | - | NC_017554.1 | Pantoea ananatis PA13 |
| 30 | 538030 | 538110 | + | NZ_CP049115.1 | Pantoea stewartii |
| 31 | 2457495 | 2457578 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 32 | 4812167 | 4812250 | + | NZ_CP026047.1 | Raoultella planticola |
| 33 | 2315858 | 2315941 | - | NZ_CP041247.1 | Raoultella electrica |
| 34 | 2441804 | 2441887 | - | NZ_CP041247.1 | Raoultella electrica |
| 35 | 710514 | 710594 | + | NZ_CP009787.1 | Yersinia rohdei |
| 36 | 2072966 | 2073046 | + | NZ_CP034148.1 | Pantoea agglomerans |
| 37 | 2115730 | 2115810 | + | NZ_CP015581.1 | Tatumella citrea |
| 38 | 5448043 | 5448123 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 39 | 1457364 | 1457444 | + | NZ_CP028271.1 | Mixta intestinalis |
| 40 | 2328430 | 2328510 | + | NZ_CP026377.1 | Mixta gaviniae |
| 41 | 2237278 | 2237358 | + | NZ_CP061511.1 | Mixta calida |
| 42 | 2014540 | 2014620 | + | NZ_LN907827.1 | Erwinia gerundensis |
| 43 | 2386817 | 2386900 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 44 | 1986112 | 1986189 | - | NZ_CP038853.1 | Pantoea vagans |
| 45 | 1996053 | 1996130 | - | NZ_CP045720.1 | Pantoea eucalypti |
| 46 | 2281770 | 2281850 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 47 | 3660121 | 3660201 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 48 | 2262729 | 2262812 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 49 | 2680373 | 2680456 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 50 | 2256184 | 2256264 | - | NZ_CP050150.1 | Hafnia alvei |
| 51 | 2013355 | 2013435 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 52 | 3845431 | 3845511 | - | NZ_CP065640.1 | Serratia rubidaea |
| 53 | 2472743 | 2472823 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 54 | 3619095 | 3619175 | - | NZ_CP019706.1 | Pantoea alhagi |
| 55 | 1907195 | 1907275 | + | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 56 | 2830860 | 2830940 | + | NZ_LR134494.1 | Serratia quinivorans |
| 57 | 1896843 | 1896923 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 58 | 4895848 | 4895928 | + | NZ_CP011254.1 | Serratia fonticola |
| 59 | 2781890 | 2781970 | + | NZ_LT906479.1 | Serratia ficaria |
| 60 | 2251645 | 2251725 | - | NC_014306.1 | Erwinia billingiae Eb661 |
| 61 | 2782288 | 2782368 | + | NZ_CP048784.1 | Serratia liquefaciens |
| 62 | 2783724 | 2783804 | + | NC_015567.1 | Serratia plymuthica AS9 |
| 63 | 4640132 | 4640215 | - | NZ_CP023525.1 | Cedecea neteri |
| 64 | 2676420 | 2676500 | + | NZ_CP023525.1 | Cedecea neteri |
| 65 | 4205574 | 4205657 | - | NZ_LR134201.1 | Cedecea lapagei |
| 66 | 2447708 | 2447788 | + | NZ_LR134201.1 | Cedecea lapagei |
| 67 | 2367747 | 2367830 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 68 | 2373663 | 2373743 | - | NZ_CP071320.1 | Serratia ureilytica |
| 69 | 2622512 | 2622592 | + | NZ_LT615367.1 | Dickeya aquatica |
| 70 | 2733082 | 2733162 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 71 | 2511157 | 2511240 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 72 | 2347255 | 2347335 | + | NZ_CP046293.1 | Yersinia intermedia |
| 73 | 2033677 | 2033757 | + | NZ_CP016948.1 | Serratia surfactantfaciens |
| 74 | 4241584 | 4241664 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 75 | 2139189 | 2139269 | - | NZ_CP051652.1 | Pectobacterium carotovorum |
| 76 | 2723573 | 2723656 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 77 | 2737493 | 2737573 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 78 | 448195 | 448275 | + | NZ_CP011078.1 | Yersinia ruckeri |
| 79 | 2261379 | 2261459 | - | NZ_CP043727.1 | Yersinia canariae |
| 80 | 2638106 | 2638189 | - | NZ_CP050508.1 | Raoultella terrigena |
| 81 | 2766554 | 2766637 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 82 | 2344947 | 2345030 | - | NZ_CP054254.1 | Klebsiella variicola |
| 83 | 2846140 | 2846223 | + | NZ_CP054254.1 | Klebsiella variicola |
| 84 | 3679902 | 3679985 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 85 | 1771085 | 1771165 | - | NZ_CP034035.1 | Brenneria rubrifaciens |
| 86 | 2154014 | 2154097 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 87 | 1411016 | 1411096 | + | NZ_CP067057.1 | Rahnella aceris |
| 88 | 2049511 | 2049591 | - | NC_012912.1 | Dickeya chrysanthemi Ech1591 |
| 89 | 2020941 | 2021021 | - | NZ_LR134373.1 | Yersinia pseudotuberculosis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT556085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00089.28 | 0.78 | 65 | 116.0 | same-strand | Trypsin |
| 2 | PF13365.8 | 0.96 | 80 | 115 | same-strand | Trypsin-like peptidase domain |
| 3 | PF02074.17 | 0.73 | 61 | 699 | same-strand | Carboxypeptidase Taq (M32) metallopeptidase |
++ More..