Result : EXP01057
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01057 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 3270250 |
| Right | 3270399 |
| Strand | - |
| Nucleotide Sequence | ATGAACCGTTGTATTCTGCTGAATCTGTCGCATCGTTCTGGTGCGCGCATGTCCCCCGCAATCTGCATCTCTGCTTTGCATACCTGCCGATGTTATACCCATCTCGGCGCTTCTCAGGATTCCAGAGCCGGCAATGGCGCTGAAGACTGA |
| Sequence | MNRCILLNLSHRSGARMSPAICISALHTCRCYTHLGASQDSRAGNGAED |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is higher in stationary phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG2 |
| ORF Length (Amino Acid) | 49 |
++ More..
| Conservation Analysis |
No. of Species: 54
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3251135 | 3251284 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1069656 | 1069799 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 4000383 | 4000520 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 4 | 4947995 | 4948138 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 5 | 2177112 | 2177255 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 1975165 | 1975308 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 3027170 | 3027313 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 3569732 | 3569875 | - | NZ_LR134340.1 | Escherichia marmotae |
| 9 | 1859188 | 1859325 | - | NZ_CP033744.1 | Citrobacter freundii |
| 10 | 5297344 | 5297478 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 11 | 3827758 | 3827901 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 12 | 3086145 | 3086288 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 13 | 3024434 | 3024577 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 14 | 704574 | 704717 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 15 | 4214061 | 4214198 | + | NZ_CP038469.1 | Citrobacter tructae |
| 16 | 820991 | 821134 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 17 | 3937215 | 3937358 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 18 | 3903448 | 3903591 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 19 | 4063609 | 4063752 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 20 | 4369757 | 4369900 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 21 | 444109 | 444255 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 22 | 4152793 | 4152939 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 23 | 590462 | 590608 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 24 | 3494113 | 3494259 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 25 | 50988 | 51131 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 26 | 930893 | 931027 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 27 | 3691702 | 3691848 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 28 | 3568701 | 3568847 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 29 | 1381704 | 1381847 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 30 | 3779918 | 3780061 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 31 | 807024 | 807173 | + | NZ_CP050508.1 | Raoultella terrigena |
| 32 | 4476820 | 4476963 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 33 | 841578 | 841730 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 34 | 3839750 | 3839893 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 35 | 1634985 | 1635128 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 36 | 562131 | 562268 | + | NZ_CP023525.1 | Cedecea neteri |
| 37 | 3910855 | 3910998 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 38 | 3884238 | 3884381 | - | NC_015968.1 | Enterobacter soli |
| 39 | 3383731 | 3383874 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 40 | 4486217 | 4486360 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 41 | 3883372 | 3883515 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 42 | 3982529 | 3982672 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 43 | 782503 | 782652 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 44 | 2583654 | 2583797 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 45 | 776050 | 776199 | + | NZ_CP054254.1 | Klebsiella variicola |
| 46 | 4480177 | 4480326 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 47 | 4241079 | 4241222 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 48 | 7222 | 7368 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 49 | 921865 | 922014 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 50 | 745995 | 746132 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 51 | 805149 | 805277 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 52 | 755258 | 755407 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 53 | 579173 | 579310 | + | NZ_LR134201.1 | Cedecea lapagei |
| 54 | 756897 | 757040 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 55 | 840336 | 840485 | + | NZ_CP060111.1 | Klebsiella michiganensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP045205.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02784.18 | 1.0 | 54 | 234 | same-strand | Pyridoxal-dependent decarboxylase, pyridoxal binding domain |
| 2 | PF17810.3 | 1.0 | 54 | 234 | same-strand | Arginine decarboxylase helical bundle domain |
| 3 | PF17944.3 | 1.0 | 54 | 234 | same-strand | Arginine decarboxylase C-terminal helical extension |
| 4 | PF02773.18 | 1.0 | 54 | 422 | opposite-strand | S-adenosylmethionine synthetase, C-terminal domain |
| 5 | PF02772.18 | 1.0 | 54 | 422 | opposite-strand | S-adenosylmethionine synthetase, central domain |
| 6 | PF00438.22 | 1.0 | 54 | 422 | opposite-strand | S-adenosylmethionine synthetase, N-terminal domain |
| 7 | PF00083.26 | 1.0 | 54 | 1996 | opposite-strand | Sugar (and other) transporter |
| 8 | PF10263.11 | 0.63 | 34 | 3500 | opposite-strand | SprT-like family |
| 9 | PF17283.4 | 0.93 | 50 | 3509 | opposite-strand | SprT-like zinc ribbon domain |
| 10 | PF04231.15 | 0.91 | 49 | 4065.5 | opposite-strand | Endonuclease I |
| 11 | PF00456.23 | 0.61 | 33 | 4498.0 | same-strand | Transketolase, thiamine diphosphate binding domain |
| 12 | PF01435.20 | 0.69 | 37 | 3466.0 | opposite-strand | Peptidase family M48 |
| 13 | PF00491.23 | 0.76 | 41 | 2428.0 | same-strand | Arginase family |
| 14 | PF04452.16 | 0.67 | 36 | 4835.5 | opposite-strand | RNA methyltransferase |
++ More..