Result : EXP01050

Protein Information

• Protein name: EXP01050
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 4485880
• Right: 4486020
• Strand: +
• Nucleotide Sequence: ATGAGGCGGATGACCGTAGACCGGATACGGCTGCCGAGGGCGATTTGCGCATTATTGGCGCGTAGCCTGGCGAGGTCCCGCTGTCCTTCCAGCAGAATAATCATATCGTCGTCGTCCAGCCAGCCGCGAGCATGTTCCTGA
• Sequence: MRRMTVDRIRLPRAICALLARSLARSRCPSSRIIISSSSSQPRACS
• Source of smORF: Protein-level
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 46

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4472354	4472494	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	2221873	2221998	+	NZ_CP053416.1	Salmonella bongori

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00155.23	1.0	2	1849.0	same-strand	Aminotransferase class I and II
2	PF03767.16	1.0	2	949.0	same-strand	HAD superfamily, subfamily IIIB (Acid phosphatase)
3	PF01894.19	1.0	2	404.5	same-strand	Uncharacterised protein family UPF0047
4	PF04237.15	1.0	2	45.5	same-strand	YjbR
5	PF17760.3	1.0	2	735.0	opposite-strand	UvrA interaction domain
6	PF17755.3	1.0	2	735.0	opposite-strand	UvrA DNA-binding domain
7	PF00436.27	1.0	2	3808.0	same-strand	Single-strand binding protein family