Result : EXP01048
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01048 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 3034796 |
| Right | 3034855 |
| Strand | + |
| Nucleotide Sequence | GTGCTAAAGATTCAGGTAAAAATTCATTTAGGGCATTTAACTGTGCATACCCGACGCTAA |
| Sequence | VLKIQVKIHLGHLTVHTRR |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3014566 | 3014625 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 835331 | 835390 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12833.9 | 1.0 | 2 | 2394.0 | both-strands | Helix-turn-helix domain |
| 2 | PF09482.12 | 1.0 | 2 | -59.0 | opposite-strand | Bacterial type III secretion apparatus protein (OrgA MxiK) |
| 3 | PF01514.19 | 1.0 | 2 | 378.0 | opposite-strand | Secretory protein of YscJ/FliF family |
| 4 | PF09392.12 | 1.0 | 2 | 1457.0 | opposite-strand | Type III secretion needle MxiH, YscF, SsaG, EprI, PscF, EscF |
| 5 | PF09480.12 | 1.0 | 2 | 1722.0 | opposite-strand | Type III secretion system protein PrgH-EprH (PrgH) |
++ More..