| Protein name |
EXP01044 |
| NCBI Accession ID |
NC_016856.1 |
| Organism |
Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left |
1370010 |
| Right |
1370051 |
| Strand |
+ |
| Nucleotide Sequence |
GTGGTAAGGATAATAATGTACTTCCGTTCGGAGGCACTATGA |
| Sequence |
VVRIIMYFRSEAL |
| Source of smORF |
Protein-level |
| Function |
It is highly induced in infection, conditions mimicking the intravacuolar compartment. Pubmed:Venturini_et_al_2020 |
| Pubmed ID |
28122954
|
| Domain |
|
| Functional Category |
Manually curated function from literature |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
13 |