Result : EXP01040
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01040 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1961837 |
| Right | 1961881 |
| Strand | - |
| Nucleotide Sequence | ATGTCCATTTTCAGAATACATTTAGATGGCAATAAAAAAGCCTGA |
| Sequence | MSIFRIHLDGNKKA |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is higher in exponential phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSF6 |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1961837 | 1961881 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1955331 | 1955375 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2543383 | 2543427 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 2563904 | 2563948 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00384.24 | 0.67 | 2 | 4830 | same-strand | Molybdopterin oxidoreductase |
| 2 | PF01568.23 | 0.67 | 2 | 4830 | same-strand | Molydopterin dinucleotide binding domain |
| 3 | PF18364.3 | 0.67 | 2 | 4830 | same-strand | Molybdopterin oxidoreductase N-terminal domain |
| 4 | PF03264.16 | 0.67 | 2 | 3705 | same-strand | NapC/NirT cytochrome c family, N-terminal region |
| 5 | PF03932.16 | 1.0 | 3 | 2571.0 | same-strand | CutC family |
| 6 | PF06185.14 | 1.0 | 3 | 1991.0 | same-strand | YecM protein |
| 7 | PF00750.21 | 1.0 | 3 | 42.0 | opposite-strand | tRNA synthetases class I (R) |
| 8 | PF05746.17 | 1.0 | 3 | 42.0 | opposite-strand | DALR anticodon binding domain |
| 9 | PF03485.18 | 1.0 | 3 | 42.0 | opposite-strand | Arginyl tRNA synthetase N terminal domain |
| 10 | PF07007.14 | 0.67 | 2 | 91 | opposite-strand | Lysozyme inhibitor LprI |
| 11 | PF06366.15 | 1.0 | 3 | 1088.5 | same-strand | Flagellar protein FlhE |
++ More..