Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01036 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 2347350 |
Right | 2347385 |
Strand | - |
Nucleotide Sequence | ATGAGTGTGTCCTGTTGGGAGTTTAATGCCGGATAA |
Sequence | MSVSCWEFNAG |
Source of smORF | Protein-level |
Function | INDUCTION: A fusion of the 5' UTR and initial codons of the gene with lacZ allows expression of beta-galactosidase, suggesting this protein is expressed (at protein level) Pubmed:30837344 |
Pubmed ID | 19121005 29645342 30837344 |
Domain | |
Functional Category | Gene Ontology/Expression based functional assignment |
Uniprot ID | P0DSF7 |
ORF Length (Amino Acid) | 11 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3073261 | 3073296 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 2347350 | 2347385 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 2364103 | 2364138 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 1373869 | 1373904 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF08241.14 | 0.67 | 2 | 7061 | opposite-strand | Methyltransferase domain |
2 | PF13649.8 | 0.67 | 2 | 7061 | opposite-strand | Methyltransferase domain |
3 | PF08242.14 | 0.67 | 2 | 7061 | opposite-strand | Methyltransferase domain |
4 | PF03797.21 | 1.0 | 3 | 3905.0 | same-strand | Autotransporter beta-domain |
5 | PF18883.2 | 1.0 | 3 | 3905.0 | same-strand | Autochaperone Domain Type 1 |
6 | PF12951.9 | 1.0 | 3 | 4237.5 | same-strand | Passenger-associated-transport-repeat |
7 | PF03212.16 | 0.67 | 2 | 4745.0 | same-strand | Pertactin |
8 | PF02867.17 | 1.0 | 3 | 196.5 | opposite-strand | Ribonucleotide reductase, barrel domain |
9 | PF03477.18 | 1.0 | 3 | 196.5 | opposite-strand | ATP cone domain |
10 | PF00317.23 | 1.0 | 3 | 196.5 | opposite-strand | Ribonucleotide reductase, all-alpha domain |
11 | PF00268.23 | 1.0 | 3 | -1.0 | opposite-strand | Ribonucleotide reductase, small chain |
12 | PF00111.29 | 1.0 | 3 | 1129.0 | opposite-strand | 2Fe-2S iron-sulfur cluster binding domain |
13 | PF06293.16 | 1.0 | 3 | 1437.0 | same-strand | Lipopolysaccharide kinase (Kdo/WaaP) family |
14 | PF07690.18 | 0.67 | 2 | 2168.0 | same-strand | Major Facilitator Superfamily |
15 | PF03009.19 | 0.67 | 2 | 2550.0 | same-strand | Glycerophosphoryl diester phosphodiesterase family |