Result : EXP01036
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01036 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2347350 |
| Right | 2347385 |
| Strand | - |
| Nucleotide Sequence | ATGAGTGTGTCCTGTTGGGAGTTTAATGCCGGATAA |
| Sequence | MSVSCWEFNAG |
| Source of smORF | Protein-level |
| Function | INDUCTION: A fusion of the 5' UTR and initial codons of the gene with lacZ allows expression of beta-galactosidase, suggesting this protein is expressed (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSF7 |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3073261 | 3073296 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2347350 | 2347385 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2364103 | 2364138 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1373869 | 1373904 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08241.14 | 0.67 | 2 | 7061 | opposite-strand | Methyltransferase domain |
| 2 | PF13649.8 | 0.67 | 2 | 7061 | opposite-strand | Methyltransferase domain |
| 3 | PF08242.14 | 0.67 | 2 | 7061 | opposite-strand | Methyltransferase domain |
| 4 | PF03797.21 | 1.0 | 3 | 3905.0 | same-strand | Autotransporter beta-domain |
| 5 | PF18883.2 | 1.0 | 3 | 3905.0 | same-strand | Autochaperone Domain Type 1 |
| 6 | PF12951.9 | 1.0 | 3 | 4237.5 | same-strand | Passenger-associated-transport-repeat |
| 7 | PF03212.16 | 0.67 | 2 | 4745.0 | same-strand | Pertactin |
| 8 | PF02867.17 | 1.0 | 3 | 196.5 | opposite-strand | Ribonucleotide reductase, barrel domain |
| 9 | PF03477.18 | 1.0 | 3 | 196.5 | opposite-strand | ATP cone domain |
| 10 | PF00317.23 | 1.0 | 3 | 196.5 | opposite-strand | Ribonucleotide reductase, all-alpha domain |
| 11 | PF00268.23 | 1.0 | 3 | -1.0 | opposite-strand | Ribonucleotide reductase, small chain |
| 12 | PF00111.29 | 1.0 | 3 | 1129.0 | opposite-strand | 2Fe-2S iron-sulfur cluster binding domain |
| 13 | PF06293.16 | 1.0 | 3 | 1437.0 | same-strand | Lipopolysaccharide kinase (Kdo/WaaP) family |
| 14 | PF07690.18 | 0.67 | 2 | 2168.0 | same-strand | Major Facilitator Superfamily |
| 15 | PF03009.19 | 0.67 | 2 | 2550.0 | same-strand | Glycerophosphoryl diester phosphodiesterase family |
++ More..