Result : EXP01033
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01033 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3109317 |
| Right | 3109400 |
| Strand | - |
| Nucleotide Sequence | ATGCACGCCATCTCCTTACATTCTCTCGCTTATCGCCGTTTCGCGCGAAACGTTTCCCTTTCTATGTTACTGCTCATGCGGTGA |
| Sequence | MHAISLHSLAYRRFARNVSLSMLLLMR |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is higher in stationary phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG3 |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3109317 | 3109400 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3051414 | 3051497 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 3851038 | 3851121 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 727763 | 727846 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3592870 | 3592953 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3050310 | 3050396 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14815.8 | 1.0 | 5 | 5252.0 | opposite-strand | NUDIX domain |
| 2 | PF00730.27 | 1.0 | 5 | 5252.0 | opposite-strand | HhH-GPD superfamily base excision DNA repair protein |
| 3 | PF00633.25 | 1.0 | 5 | 5252.0 | opposite-strand | Helix-hairpin-helix motif |
| 4 | PF10576.11 | 1.0 | 5 | 5252.0 | opposite-strand | Iron-sulfur binding domain of endonuclease III |
| 5 | PF04362.16 | 1.0 | 5 | 4949.0 | opposite-strand | Bacterial Fe(2+) trafficking |
| 6 | PF11873.10 | 1.0 | 5 | 3804.5 | opposite-strand | Membrane-bound lytic murein transglycosylase C, N-terminal domain |
| 7 | PF01464.22 | 1.0 | 5 | 3804.5 | opposite-strand | Transglycosylase SLT domain |
| 8 | PF03825.18 | 1.0 | 5 | 2347.0 | opposite-strand | Nucleoside H+ symporter |
| 9 | PF12832.9 | 1.0 | 5 | 2347.0 | opposite-strand | MFS 1 like family |
| 10 | PF01276.22 | 1.0 | 5 | 162.5 | same-strand | Orn/Lys/Arg decarboxylase, major domain |
| 11 | PF03711.17 | 1.0 | 5 | 162.5 | same-strand | Orn/Lys/Arg decarboxylase, C-terminal domain |
| 12 | PF03709.17 | 1.0 | 5 | 162.5 | same-strand | Orn/Lys/Arg decarboxylase, N-terminal domain |
| 13 | PF04474.14 | 0.8 | 4 | 153 | opposite-strand | Protein of unknown function (DUF554) |
++ More..