Result : EXP01030
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01030 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3838642 |
| Right | 3838701 |
| Strand | - |
| Nucleotide Sequence | ATGACGTCGGATTACCGTGTGTCACCAATAAAAAAGTCCCGACCAGCGATGTCAAAATAG |
| Sequence | MTSDYRVSPIKKSRPAMSK |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in equally in both exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSH5 |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3838642 | 3838701 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3774064 | 3774123 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 4625101 | 4625160 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 1.0 | 2 | 1201.5 | both-strands | Major Facilitator Superfamily |
| 2 | PF00892.22 | 1.0 | 2 | -59 | opposite-strand | EamA-like transporter family |
| 3 | PF03180.16 | 1.0 | 2 | 474 | same-strand | NlpA lipoprotein |
| 4 | PF00860.22 | 1.0 | 2 | 3929.5 | same-strand | Permease family |
++ More..