Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01030 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 3838642 |
Right | 3838701 |
Strand | - |
Nucleotide Sequence | ATGACGTCGGATTACCGTGTGTCACCAATAAAAAAGTCCCGACCAGCGATGTCAAAATAG |
Sequence | MTSDYRVSPIKKSRPAMSK |
Source of smORF | Protein-level |
Function | INDUCTION: Expressed in equally in both exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
Pubmed ID | 19121005 29645342 30837344 |
Domain | |
Functional Category | Gene Ontology/Expression based functional assignment |
Uniprot ID | P0DSH5 |
ORF Length (Amino Acid) | 19 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3838642 | 3838701 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 3774064 | 3774123 | + | NZ_CP061527.1 | Shigella dysenteriae |
3 | 4625101 | 4625160 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF07690.18 | 1.0 | 2 | 1201.5 | both-strands | Major Facilitator Superfamily |
2 | PF00892.22 | 1.0 | 2 | -59 | opposite-strand | EamA-like transporter family |
3 | PF03180.16 | 1.0 | 2 | 474 | same-strand | NlpA lipoprotein |
4 | PF00860.22 | 1.0 | 2 | 3929.5 | same-strand | Permease family |