Result : EXP01028
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01028 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3640612 |
| Right | 3640686 |
| Strand | - |
| Nucleotide Sequence | ATGTTGTATTGGCTGGGGATTTTGATTGCGTACGCAGACCGTAGGCCAGATAAGGTGTTTACGCTGATCAGGTAA |
| Sequence | MLYWLGILIAYADRRPDKVFTLIR |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is higher in exponential phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG9 |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3640612 | 3640686 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4375049 | 4375120 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 308128 | 308199 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03486.16 | 1.0 | 2 | 3029 | same-strand | HI0933-like protein |
| 2 | PF01384.22 | 1.0 | 2 | 1298 | opposite-strand | Phosphate transporter family |
| 3 | PF10625.11 | 1.0 | 2 | 892 | same-strand | Universal stress protein B (UspB) |
| 4 | PF00582.28 | 1.0 | 2 | 67 | opposite-strand | Universal stress protein family |
| 5 | PF00854.23 | 1.0 | 2 | 179 | opposite-strand | POT family |
| 6 | PF07690.18 | 1.0 | 2 | 179 | opposite-strand | Major Facilitator Superfamily |
| 7 | PF04445.15 | 1.0 | 2 | 1694 | same-strand | Putative SAM-dependent methyltransferase |
| 8 | PF01432.22 | 1.0 | 2 | 2454 | same-strand | Peptidase family M3 |
| 9 | PF19310.1 | 1.0 | 2 | 2454 | same-strand | Neurolysin/Thimet oligopeptidase, N-terminal domain |
| 10 | PF04378.15 | 1.0 | 2 | 4699 | opposite-strand | Ribosomal RNA large subunit methyltransferase D, RlmJ |
++ More..