Result : EXP01017
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01017 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 837503 |
| Right | 837562 |
| Strand | + |
| Nucleotide Sequence | ATGCGTCTGTCGGCAAACAGACAGGGAAATACTTGTGCTGGACGTAGCGTAAACGCCTGA |
| Sequence | MRLSANRQGNTCAGRSVNA |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is higher in stationary phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSE7 |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 961944 | 962003 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 837503 | 837562 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 780128 | 780187 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2867952 | 2868011 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1307631 | 1307690 | - | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00270.31 | 0.75 | 3 | 5238.0 | same-strand | DEAD/DEAH box helicase |
| 2 | PF00271.33 | 0.75 | 3 | 5238.0 | same-strand | Helicase conserved C-terminal domain |
| 3 | PF04851.17 | 1.0 | 4 | 2286 | same-strand | Type III restriction enzyme, res subunit |
| 4 | PF13245.8 | 0.75 | 3 | 5238.0 | same-strand | AAA domain |
| 5 | PF13307.8 | 1.0 | 4 | 2283 | same-strand | Helicase C-terminal domain |
| 6 | PF02885.19 | 1.0 | 4 | 1293 | same-strand | Glycosyl transferase family, helical bundle domain |
| 7 | PF00591.23 | 0.75 | 3 | 1293.0 | same-strand | Glycosyl transferase family, a/b domain |
| 8 | PF02615.16 | 1.0 | 4 | 67 | same-strand | Malate/L-lactate dehydrogenase |
| 9 | PF07338.15 | 1.0 | 4 | 103.0 | opposite-strand | Protein of unknown function (DUF1471) |
| 10 | PF01258.19 | 1.0 | 4 | 628 | opposite-strand | Prokaryotic dksA/traR C4-type zinc finger |
| 11 | PF18331.3 | 1.0 | 4 | 968 | opposite-strand | PKHD-type hydroxylase C-terminal domain |
| 12 | PF13640.8 | 1.0 | 4 | 968 | opposite-strand | 2OG-Fe(II) oxygenase superfamily |
| 13 | PF00593.26 | 0.75 | 3 | 1687.5 | opposite-strand | TonB dependent receptor |
++ More..