Result : EXP01015

Protein Information

• Protein name: EXP01015
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 4518372
• Right: 4518440
• Strand: +
• Nucleotide Sequence: ATGGGATGGAGCCTCTGCTTCTGGCATGTGTCGGTCAGAATGACTCATGATGTGGTCTGCTATTATTGA
• Sequence: MGWSLCFWHVSVRMTHDVVCYY
• Source of smORF: Protein-level
• Function: INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is higher in stationary phase (at protein level) Pubmed:30837344
• Pubmed ID: 19121005 29645342 30837344
• Functional Category: Gene Ontology/Expression based functional assignment
• Uniprot ID: P0DSH9
• ORF Length (Amino Acid): 22

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4518372	4518440	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	3955346	3955414	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF16220.7	1.0	2	1042.0	opposite-strand	Domain of unknown function (DUF4880)
2	PF16344.7	1.0	2	1343.5	opposite-strand	Domain of unknown function (DUF4974)
3	PF08281.14	1.0	2	524.0	opposite-strand	Sigma-70, region 4
4	PF04542.16	1.0	2	524.0	opposite-strand	Sigma-70 region 2
5	PF04545.18	1.0	2	524.0	opposite-strand	Sigma-70, region 4