Result : EXP01012
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01012 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3111266 |
| Right | 3111325 |
| Strand | + |
| Nucleotide Sequence | GTGAAGTATCTGGCGTTTTTGATCAAAGGTAAAACCACGCATTTCGATGTCGGAAAGTGA |
| Sequence | VKYLAFLIKGKTTHFDVGK |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed equally in exponential and stationary phase in rich medium (at protein level) A shorter isoform that starts downstream at a TTG codon (yielding a 13 residue peptide) may also be expressed Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG4 |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3111266 | 3111325 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 730479 | 730538 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 3613522 | 3613581 | + | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 2019207 | 2019266 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 3062598 | 3062657 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP061527.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04612.14 | 1.0 | 5 | 140 | opposite-strand | Type II secretion system (T2SS), protein M |
| 2 | PF12693.9 | 1.0 | 5 | -59 | opposite-strand | GspL periplasmic domain |
| 3 | PF03934.15 | 0.8 | 4 | 978.0 | opposite-strand | Type II secretion system (T2SS), protein K |
| 4 | PF14341.8 | 0.6 | 3 | 978 | opposite-strand | PilX N-terminal |
| 5 | PF11612.10 | 0.8 | 4 | 1952.0 | opposite-strand | Type II secretion system (T2SS), protein J |
| 6 | PF07963.14 | 0.8 | 4 | 2554 | opposite-strand | Prokaryotic N-terminal methylation motif |
| 7 | PF02501.19 | 0.8 | 4 | 2554.0 | opposite-strand | Type II secretion system (T2SS), protein I |
| 8 | PF12019.10 | 0.8 | 4 | 2922.0 | opposite-strand | Type II transport protein GspH |
| 9 | PF08334.13 | 0.6 | 3 | 3489 | opposite-strand | Type II secretion system (T2SS), protein G |
++ More..