Result : EXP01011
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01011 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3720400 |
| Right | 3720471 |
| Strand | + |
| Nucleotide Sequence | ATGCGCAACGCCGTAAGTAAGGCGGGAATAATTTCCCGCCGAAGACTCTTACTCTTTCAATTTGCAGGCTAA |
| Sequence | MRNAVSKAGIISRRRLLLFQFAG |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is considerably higher during exponential phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSH1 |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3720400 | 3720471 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3691464 | 3691535 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 3691273 | 3691344 | + | NZ_AP014857.1 | Escherichia albertii |
| 4 | 3911758 | 3911829 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2642941 | 2643018 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 4468100 | 4468171 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 7 | 1790477 | 1790536 | + | NC_018645.1 | Desulfobacula toluolica Tol2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00691.22 | 0.67 | 4 | 3194 | same-strand | OmpA family |
| 2 | PF02826.21 | 0.67 | 4 | 2116 | same-strand | D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain |
| 3 | PF00389.32 | 0.67 | 4 | 2116 | same-strand | D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain |
| 4 | PF11254.10 | 0.83 | 5 | 1356.0 | opposite-strand | Protein of unknown function (DUF3053) |
| 5 | PF00313.24 | 0.83 | 5 | 140.0 | same-strand | 'Cold-shock' DNA-binding domain |
| 6 | PF01848.18 | 0.67 | 4 | -23 | opposite-strand | Hok/gef family |
| 7 | PF02092.19 | 0.67 | 4 | 452 | opposite-strand | Glycyl-tRNA synthetase beta subunit |
| 8 | PF05746.17 | 0.67 | 4 | 452 | opposite-strand | DALR anticodon binding domain |
| 9 | PF02091.17 | 0.67 | 4 | 2531 | opposite-strand | Glycyl-tRNA synthetase alpha subunit |
++ More..