Result : EXP01008
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01008 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3247668 |
| Right | 3247751 |
| Strand | + |
| Nucleotide Sequence | GTGTTGATGTATCAAACCCGCAGAACATACCAAAACAGCAATAACATTGCGGTAGTGCATCTTTTAAAACCAGCGTGGCGTTAA |
| Sequence | VLMYQTRRTYQNSNNIAVVHLLKPAWR |
| Source of smORF | Protein-level |
| Function | INDUCTION: Expressed at low levels in exponential phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 19121005 29645342 30837344 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG5 |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3987428 | 3987511 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3247668 | 3247751 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3239645 | 3239728 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 558840 | 558923 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02614.16 | 0.67 | 2 | 2927 | opposite-strand | Glucuronate isomerase |
| 2 | PF00392.23 | 1.0 | 3 | 240.0 | same-strand | Bacterial regulatory proteins, gntR family |
| 3 | PF07729.14 | 1.0 | 3 | 240.0 | same-strand | FCD domain |
| 4 | PF09335.13 | 1.0 | 3 | 22.0 | same-strand | SNARE associated Golgi protein |
| 5 | PF13721.8 | 1.0 | 3 | 688.0 | same-strand | SecD export protein N-terminal TM region |
| 6 | PF06476.14 | 1.0 | 3 | 1218.0 | same-strand | Protein of unknown function (DUF1090) |
| 7 | PF19029.2 | 1.0 | 3 | 1624.0 | same-strand | DUF883 C-terminal glycine zipper region |
| 8 | PF05957.15 | 1.0 | 3 | 1624.0 | same-strand | DUF883 N-terminal domain |
| 9 | PF07332.13 | 1.0 | 3 | 1932.0 | same-strand | Putative Actinobacterial Holin-X, holin superfamily III |
++ More..