Result : EXP00999
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00999 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2263029 |
| Right | 2263097 |
| Strand | - |
| Nucleotide Sequence | ATGACGCTGAATAATCCCCACATCAGGCCCATTACACCGTACTCCCGAGGATCACAATGCCGCCAATAA |
| Sequence | MTLNNPHIRPITPYSRGSQCRQ |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2372855 | 2372923 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3103503 | 3103571 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1348874 | 1348942 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 2915111 | 2915179 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 4427071 | 4427139 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 2385583 | 2385651 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 7 | 2373262 | 2373330 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00535.28 | 0.83 | 5 | 4816.0 | opposite-strand | Glycosyl transferase family 2 |
| 2 | PF01370.23 | 1.0 | 6 | 2840 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 3 | PF16363.7 | 0.83 | 5 | 2837.0 | opposite-strand | GDP-mannose 4,6 dehydratase |
| 4 | PF02911.20 | 1.0 | 6 | 2840 | opposite-strand | Formyl transferase, C-terminal domain |
| 5 | PF01522.23 | 1.0 | 6 | 1947 | opposite-strand | Polysaccharide deacetylase |
| 6 | PF02366.20 | 1.0 | 6 | 295 | opposite-strand | Dolichyl-phosphate-mannose-protein mannosyltransferase |
| 7 | PF13231.8 | 1.0 | 6 | 295 | opposite-strand | Dolichyl-phosphate-mannose-protein mannosyltransferase |
| 8 | PF00893.21 | 1.0 | 6 | -37 | opposite-strand | Small Multidrug Resistance protein |
| 9 | PF11183.10 | 1.0 | 6 | 349 | same-strand | Polymyxin resistance protein PmrD |
| 10 | PF00501.30 | 1.0 | 6 | 725 | same-strand | AMP-binding enzyme |
| 11 | PF13193.8 | 1.0 | 6 | 725 | same-strand | AMP-binding enzyme C-terminal domain |
| 12 | PF00378.22 | 1.0 | 6 | 3039 | same-strand | Enoyl-CoA hydratase/isomerase |
++ More..