Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00991 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 3917763 |
Right | 3917813 |
Strand | - |
Nucleotide Sequence | ATGAAAAACATCAGACTTGGACATATACAACTCCTCTGTGAATCGGTTTAG |
Sequence | MKNIRLGHIQLLCESV |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 16 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4812840 | 4812890 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 3986902 | 3986952 | - | NZ_AP014857.1 | Escherichia albertii |
3 | 4016404 | 4016454 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
4 | 4029543 | 4029593 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
5 | 2745516 | 2745566 | + | NZ_CP057657.1 | Escherichia fergusonii |
6 | 4318418 | 4318468 | + | NZ_LR134340.1 | Escherichia marmotae |
7 | 4349516 | 4349566 | - | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00892.22 | 0.67 | 4 | 4428 | opposite-strand | EamA-like transporter family |
2 | PF03466.22 | 0.67 | 4 | 3587 | same-strand | LysR substrate binding domain |
3 | PF00126.29 | 0.67 | 4 | 3587 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
4 | PF01717.20 | 0.67 | 4 | 1090 | opposite-strand | Cobalamin-independent synthase, Catalytic domain |
5 | PF08267.14 | 0.67 | 4 | 1090 | opposite-strand | Cobalamin-independent synthase, N-terminal domain |
6 | PF01738.20 | 1.0 | 6 | 235 | same-strand | Dienelactone hydrolase family |
7 | PF01048.22 | 1.0 | 6 | -23 | opposite-strand | Phosphorylase superfamily |
8 | PF02646.18 | 0.83 | 5 | 879.0 | opposite-strand | RmuC family |
9 | PF01209.20 | 0.83 | 5 | 2401.0 | opposite-strand | ubiE/COQ5 methyltransferase family |
10 | PF13649.8 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
11 | PF08241.14 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
12 | PF13847.8 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
13 | PF13489.8 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
14 | PF08242.14 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
15 | PF02036.19 | 0.83 | 5 | 3170.0 | opposite-strand | SCP-2 sterol transfer family |
16 | PF03109.18 | 0.83 | 5 | 3772.0 | opposite-strand | ABC1 atypical kinase-like domain |