Result : EXP00991
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00991 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3917763 |
| Right | 3917813 |
| Strand | - |
| Nucleotide Sequence | ATGAAAAACATCAGACTTGGACATATACAACTCCTCTGTGAATCGGTTTAG |
| Sequence | MKNIRLGHIQLLCESV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4812840 | 4812890 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3986902 | 3986952 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 4016404 | 4016454 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 4029543 | 4029593 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 2745516 | 2745566 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 4318418 | 4318468 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 4349516 | 4349566 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00892.22 | 0.67 | 4 | 4428 | opposite-strand | EamA-like transporter family |
| 2 | PF03466.22 | 0.67 | 4 | 3587 | same-strand | LysR substrate binding domain |
| 3 | PF00126.29 | 0.67 | 4 | 3587 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 4 | PF01717.20 | 0.67 | 4 | 1090 | opposite-strand | Cobalamin-independent synthase, Catalytic domain |
| 5 | PF08267.14 | 0.67 | 4 | 1090 | opposite-strand | Cobalamin-independent synthase, N-terminal domain |
| 6 | PF01738.20 | 1.0 | 6 | 235 | same-strand | Dienelactone hydrolase family |
| 7 | PF01048.22 | 1.0 | 6 | -23 | opposite-strand | Phosphorylase superfamily |
| 8 | PF02646.18 | 0.83 | 5 | 879.0 | opposite-strand | RmuC family |
| 9 | PF01209.20 | 0.83 | 5 | 2401.0 | opposite-strand | ubiE/COQ5 methyltransferase family |
| 10 | PF13649.8 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
| 11 | PF08241.14 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
| 12 | PF13847.8 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
| 13 | PF13489.8 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
| 14 | PF08242.14 | 0.83 | 5 | 2401.0 | opposite-strand | Methyltransferase domain |
| 15 | PF02036.19 | 0.83 | 5 | 3170.0 | opposite-strand | SCP-2 sterol transfer family |
| 16 | PF03109.18 | 0.83 | 5 | 3772.0 | opposite-strand | ABC1 atypical kinase-like domain |
++ More..