Result : EXP00987
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00987 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3190697 |
| Right | 3190756 |
| Strand | - |
| Nucleotide Sequence | ATGGGAAAATCTGAGTGCACCGGTGAAAACCGAACAAACTCAACCAGCTGCTCCGGCTAA |
| Sequence | MGKSECTGENRTNSTSCSG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3322198 | 3322257 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3314381 | 3314440 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2247009 | 2247068 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 4064824 | 4064883 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 3305769 | 3305828 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 3827497 | 3827556 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 494457 | 494516 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 8 | 5345307 | 5345366 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 9 | 1780124 | 1780183 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 10 | 583064 | 583123 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02576.19 | 0.89 | 8 | 4192 | same-strand | RimP N-terminal domain |
| 2 | PF17384.4 | 0.89 | 8 | 4192 | same-strand | RimP C-terminal SH3 domain |
| 3 | PF00764.21 | 0.89 | 8 | 2218 | opposite-strand | Arginosuccinate synthase |
| 4 | PF03840.16 | 1.0 | 9 | -59.0 | same-strand | Preprotein translocase SecG subunit |
| 5 | PF02878.18 | 1.0 | 9 | 476.0 | same-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
| 6 | PF02880.18 | 1.0 | 9 | 476.0 | same-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
| 7 | PF02879.18 | 1.0 | 9 | 476.0 | same-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II |
| 8 | PF00408.22 | 1.0 | 9 | 476.0 | same-strand | Phosphoglucomutase/phosphomannomutase, C-terminal domain |
| 9 | PF00809.24 | 1.0 | 9 | 1806.0 | same-strand | Pterin binding enzyme |
| 10 | PF01434.20 | 1.0 | 9 | 2744.0 | same-strand | Peptidase family M41 |
| 11 | PF00004.31 | 1.0 | 9 | 2744.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 12 | PF06480.17 | 1.0 | 9 | 2744.0 | same-strand | FtsH Extracellular |
| 13 | PF17862.3 | 1.0 | 9 | 2744.0 | same-strand | AAA+ lid domain |
| 14 | PF07728.16 | 1.0 | 9 | 2744.0 | same-strand | AAA domain (dynein-related subfamily) |
| 15 | PF01728.21 | 1.0 | 9 | 4778.0 | same-strand | FtsJ-like methyltransferase |
| 16 | PF01985.23 | 0.67 | 6 | 5533 | opposite-strand | CRS1 / YhbY (CRM) domain |
++ More..