Result : EXP00983
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00983 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 657277 |
| Right | 657330 |
| Strand | - |
| Nucleotide Sequence | TTGATTCTGATATGCAGTAAGGAAATGTTCCGGGTTTGCCACATCACTGTTTGA |
| Sequence | LILICSKEMFRVCHITV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 777567 | 777620 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 697403 | 697456 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 654262 | 654315 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03471.19 | 1.0 | 2 | 5620 | same-strand | Transporter associated domain |
| 2 | PF00571.30 | 1.0 | 2 | 5620 | same-strand | CBS domain |
| 3 | PF02130.19 | 1.0 | 2 | 5063 | same-strand | Endoribonuclease YbeY |
| 4 | PF02562.18 | 1.0 | 2 | 3987 | same-strand | PhoH-like protein |
| 5 | PF13245.8 | 1.0 | 2 | 3987 | same-strand | AAA domain |
| 6 | PF00919.22 | 1.0 | 2 | 2449 | same-strand | Uncharacterized protein family UPF0004 |
| 7 | PF04055.23 | 1.0 | 2 | 2449 | same-strand | Radical SAM superfamily |
| 8 | PF01938.22 | 1.0 | 2 | 2449 | same-strand | TRAM domain |
| 9 | PF01494.21 | 1.0 | 2 | 1128 | opposite-strand | FAD binding domain |
| 10 | PF13537.8 | 1.0 | 2 | 57 | same-strand | Glutamine amidotransferase domain |
| 11 | PF13522.8 | 1.0 | 2 | 57 | same-strand | Glutamine amidotransferase domain |
| 12 | PF13242.8 | 1.0 | 2 | 2001 | same-strand | HAD-hyrolase-like |
| 13 | PF00480.22 | 1.0 | 2 | 2801 | same-strand | ROK family |
| 14 | PF13412.8 | 1.0 | 2 | 2801 | same-strand | Winged helix-turn-helix DNA-binding |
| 15 | PF01979.22 | 1.0 | 2 | 4030 | same-strand | Amidohydrolase family |
++ More..