Result : EXP00982
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00982 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1853288 |
| Right | 1853359 |
| Strand | - |
| Nucleotide Sequence | GTGATAACAGATTTCGGGTTAAACGAGGTACAGTTCTGTTTATGTGTGGCATTTTCAGTAAAGAAGTCCTGA |
| Sequence | VITDFGLNEVQFCLCVAFSVKKS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 53
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2509528 | 2509599 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1907561 | 1907632 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1811496 | 1811567 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 2106127 | 2106198 | + | NZ_CP050508.1 | Raoultella terrigena |
| 5 | 2065751 | 2065822 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 6 | 561427 | 561498 | - | NZ_CP033744.1 | Citrobacter freundii |
| 7 | 4522056 | 4522127 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 8 | 1366378 | 1366449 | - | NZ_CP038469.1 | Citrobacter tructae |
| 9 | 2343937 | 2344008 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 10 | 5211660 | 5211731 | - | NZ_CP026047.1 | Raoultella planticola |
| 11 | 1991244 | 1991315 | + | NZ_CP041247.1 | Raoultella electrica |
| 12 | 1441888 | 1441959 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 13 | 2595177 | 2595248 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 14 | 1464737 | 1464808 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 15 | 2513027 | 2513098 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 16 | 2553950 | 2554021 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 17 | 1631582 | 1631653 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 18 | 896682 | 896753 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 19 | 1881187 | 1881258 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 20 | 2252986 | 2253057 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 21 | 1949210 | 1949281 | + | NZ_CP054254.1 | Klebsiella variicola |
| 22 | 2789916 | 2789987 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 23 | 1983968 | 1984039 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 24 | 3336168 | 3336239 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 25 | 4152804 | 4152875 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 26 | 1117706 | 1117777 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 27 | 2677894 | 2677965 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 28 | 1935879 | 1935950 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 29 | 4446887 | 4446958 | - | NZ_CP053416.1 | Salmonella bongori |
| 30 | 2012905 | 2012976 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 31 | 1840475 | 1840546 | - | NZ_AP014857.1 | Escherichia albertii |
| 32 | 1883002 | 1883073 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 33 | 2537968 | 2538039 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 34 | 3766442 | 3766513 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 35 | 2017552 | 2017623 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 36 | 2886094 | 2886165 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 37 | 4493081 | 4493152 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 38 | 2728314 | 2728385 | - | NC_015968.1 | Enterobacter soli |
| 39 | 2797901 | 2797972 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 40 | 2796853 | 2796924 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 41 | 2774469 | 2774540 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 42 | 603190 | 603261 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 43 | 1893199 | 1893270 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 44 | 1800468 | 1800539 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 45 | 4061321 | 4061392 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 46 | 1545258 | 1545329 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 47 | 2979918 | 2979989 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 48 | 2227475 | 2227546 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 49 | 125283 | 125354 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 50 | 2850633 | 2850704 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 51 | 264106 | 264177 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 52 | 1812238 | 1812312 | + | NZ_CP038853.1 | Pantoea vagans |
| 53 | 1967028 | 1967099 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 54 | 1830724 | 1830798 | + | NZ_CP045720.1 | Pantoea eucalypti |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP050508.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06173.14 | 0.94 | 50 | 4115 | opposite-strand | Protein of unknown function (DUF986) |
| 2 | PF02659.17 | 0.96 | 51 | 3132.0 | opposite-strand | Putative manganese efflux pump |
| 3 | PF13649.8 | 1.0 | 53 | 2334.5 | same-strand | Methyltransferase domain |
| 4 | PF08241.14 | 1.0 | 53 | 2334.5 | same-strand | Methyltransferase domain |
| 5 | PF00313.24 | 1.0 | 53 | 127.0 | same-strand | 'Cold-shock' DNA-binding domain |
| 6 | PF13974.8 | 1.0 | 53 | 694.5 | same-strand | YebO-like protein |
| 7 | PF13996.8 | 1.0 | 53 | 1366.0 | opposite-strand | YobH-like protein |
| 8 | PF01614.20 | 0.98 | 52 | 1721 | same-strand | Bacterial transcriptional regulator |
| 9 | PF09339.12 | 0.98 | 52 | 1721 | same-strand | IclR helix-turn-helix domain |
| 10 | PF13412.8 | 0.98 | 52 | 1721 | same-strand | Winged helix-turn-helix DNA-binding |
| 11 | PF07690.18 | 0.72 | 38 | 2644 | opposite-strand | Major Facilitator Superfamily |
| 12 | PF00905.24 | 0.6 | 32 | 555.0 | same-strand | Penicillin binding protein transpeptidase domain |
| 13 | PF03717.17 | 0.6 | 32 | 555.0 | same-strand | Penicillin-binding Protein dimerisation domain |
++ More..