Result : EXP00977
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00977 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3338028 |
| Right | 3338114 |
| Strand | - |
| Nucleotide Sequence | ATGCTCAGGAGATATCATGAAAGTAGCAAAAGACCTGGTGGTCAGCCTGGCCTATCAGGTACGTACAGAAGACGGTGTGTTGGTTGA |
| Sequence | MLRRYHESSKRPGGQPGLSGTYRRRCVG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 45
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 492886 | 492972 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 2 | 412087 | 412173 | + | NZ_CP050508.1 | Raoultella terrigena |
| 3 | 448784 | 448870 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 4 | 4198461 | 4198547 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 1267890 | 1267976 | - | NZ_CP026047.1 | Raoultella planticola |
| 6 | 410446 | 410532 | + | NZ_CP041247.1 | Raoultella electrica |
| 7 | 413994 | 414080 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 8 | 3606842 | 3606928 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 9 | 4361784 | 4361870 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 10 | 4190979 | 4191065 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 11 | 3439325 | 3439411 | - | NZ_AP014857.1 | Escherichia albertii |
| 12 | 3478427 | 3478513 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 13 | 3447704 | 3447790 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 14 | 1456974 | 1457060 | - | NZ_CP053416.1 | Salmonella bongori |
| 15 | 3966503 | 3966589 | - | NZ_LR134340.1 | Escherichia marmotae |
| 16 | 361708 | 361794 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 17 | 2384610 | 2384696 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 18 | 1167628 | 1167714 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 19 | 2869552 | 2869638 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 20 | 532036 | 532122 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 21 | 2265528 | 2265614 | - | NZ_CP033744.1 | Citrobacter freundii |
| 22 | 2817338 | 2817424 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 23 | 3815727 | 3815813 | + | NZ_CP038469.1 | Citrobacter tructae |
| 24 | 444544 | 444639 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 25 | 299215 | 299310 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 26 | 3226256 | 3226351 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 27 | 500436 | 500531 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 28 | 4426007 | 4426102 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 29 | 459517 | 459612 | + | NZ_CP051652.1 | Pectobacterium carotovorum |
| 30 | 2117757 | 2117852 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 31 | 4414675 | 4414770 | - | NZ_CP034938.1 | Pectobacterium odoriferum |
| 32 | 1153697 | 1153792 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 33 | 4715689 | 4715784 | + | NZ_CP015749.1 | Pectobacterium parmentieri |
| 34 | 1674461 | 1674556 | - | NZ_CP015137.1 | Dickeya solani IPO 2222 |
| 35 | 455390 | 455485 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 36 | 4215906 | 4216001 | - | NZ_CP025799.1 | Dickeya zeae |
| 37 | 4254351 | 4254446 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 38 | 358529 | 358624 | + | NC_012912.1 | Dickeya chrysanthemi Ech1591 |
| 39 | 474851 | 474949 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 40 | 4065462 | 4065557 | - | NZ_LT615367.1 | Dickeya aquatica |
| 41 | 4786627 | 4786722 | + | NZ_CP014137.1 | Brenneria goodwinii |
| 42 | 5023908 | 5024000 | - | NC_015567.1 | Serratia plymuthica AS9 |
| 43 | 135203 | 135298 | + | NZ_CP034035.1 | Brenneria rubrifaciens |
| 44 | 303427 | 303528 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 45 | 375546 | 375635 | + | NZ_CP048796.1 | Providencia vermicola |
| 46 | 1213822 | 1213914 | - | NZ_LR134327.1 | Aggregatibacter aphrophilus ATCC 33389 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP060111.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 0.98 | 44 | 2822 | opposite-strand | ABC transporter |
| 2 | PF12848.9 | 0.98 | 44 | 2822 | opposite-strand | ABC transporter |
| 3 | PF16326.7 | 0.98 | 44 | 2822 | opposite-strand | ABC transporter C-terminal domain |
| 4 | PF02525.19 | 0.98 | 44 | 2095 | same-strand | Flavodoxin-like fold |
| 5 | PF00999.23 | 0.93 | 42 | 293 | same-strand | Sodium/hydrogen exchanger family |
| 6 | PF02254.20 | 1.0 | 45 | 293.0 | same-strand | TrkA-N domain |
| 7 | PF00254.30 | 1.0 | 45 | -70.0 | same-strand | FKBP-type peptidyl-prolyl cis-trans isomerase |
| 8 | PF04102.14 | 0.91 | 41 | 617.5 | opposite-strand | SlyX |
| 9 | PF01346.20 | 0.82 | 37 | 1085.5 | same-strand | Domain amino terminal to FKBP-type peptidyl-prolyl isomerase |
| 10 | PF08348.13 | 0.64 | 29 | 2078.5 | same-strand | YheO-like PAS domain |
| 11 | PF13309.8 | 0.64 | 29 | 2078.5 | same-strand | HTH domain |
| 12 | PF13384.8 | 0.62 | 28 | 2066 | same-strand | Homeodomain-like domain |
| 13 | PF02635.17 | 0.62 | 28 | 2788 | same-strand | DsrE/DsrF-like family |
++ More..