Result : EXP00976
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00976 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3817249 |
| Right | 3817296 |
| Strand | - |
| Nucleotide Sequence | ATGAGCTTTCAGGCCCACAAGGCATCGAACAAGCAATCCGTTTTTTAA |
| Sequence | MSFQAHKASNKQSVF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4722017 | 4722064 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3928448 | 3928495 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3935715 | 3935762 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4253789 | 4253836 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4414615 | 4414662 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3895332 | 3895379 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01134.24 | 1.0 | 5 | 2815.0 | same-strand | Glucose inhibited division protein A |
| 2 | PF13932.8 | 1.0 | 5 | 2815.0 | same-strand | tRNA modifying enzyme MnmG/GidA C-terminal domain |
| 3 | PF00258.27 | 1.0 | 5 | 1993.0 | same-strand | Flavodoxin |
| 4 | PF01037.23 | 1.0 | 5 | 1445.0 | same-strand | Lrp/AsnC ligand binding domain |
| 5 | PF13412.8 | 1.0 | 5 | 1445.0 | same-strand | Winged helix-turn-helix DNA-binding |
| 6 | PF13404.8 | 1.0 | 5 | 1445.0 | same-strand | AsnC-type helix-turn-helix domain |
| 7 | PF03590.17 | 1.0 | 5 | 301.0 | opposite-strand | Aspartate-ammonia ligase |
| 8 | PF13519.8 | 1.0 | 5 | -47.0 | same-strand | von Willebrand factor type A domain |
| 9 | PF20030.1 | 1.0 | 5 | 1102.0 | same-strand | MoxR domain in the MoxR-vWA-beta-propeller ternary systems |
| 10 | PF07728.16 | 1.0 | 5 | 1102.0 | same-strand | AAA domain (dynein-related subfamily) |
| 11 | PF12592.10 | 1.0 | 5 | 1102.0 | same-strand | Protein of unknown function (DUF3763) |
| 12 | PF17868.3 | 1.0 | 5 | 1102.0 | same-strand | AAA lid domain |
| 13 | PF07726.13 | 0.8 | 4 | 1102 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 14 | PF02705.18 | 1.0 | 5 | 2822.5 | opposite-strand | K+ potassium transporter |
| 15 | PF05025.15 | 0.8 | 4 | 4857 | opposite-strand | RbsD / FucU transport protein family |
| 16 | PF00005.29 | 0.6 | 3 | 5283.5 | opposite-strand | ABC transporter |
++ More..