| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00974 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4251410 |
| Right | 4251487 |
| Strand | - |
| Nucleotide Sequence | ATGACCTGTAATACCCAGAAAAGCGCCGTTCCCACATTCAGCAAAATACCCGCAATCACAATGAGGACGACGTTGTGA |
| Sequence | MTCNTQKSAVPTFSKIPAITMRTTL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5198907 | 5198984 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4344331 | 4344408 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 4264148 | 4264225 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 370304 | 370381 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 835418 | 835495 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 6 | 2289365 | 2289442 | - | NZ_CP053416.1 | Salmonella bongori |
| 7 | 894179 | 894256 | + | NC_017554.1 | Pantoea ananatis PA13 |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00165.25 | 1.0 | 6 | 2703.0 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 2 | PF12833.9 | 1.0 | 6 | 2703.0 | same-strand | Helix-turn-helix domain |
| 3 | PF01276.22 | 0.67 | 4 | 3807 | same-strand | Orn/Lys/Arg decarboxylase, major domain |
| 4 | PF03711.17 | 0.67 | 4 | 3807 | same-strand | Orn/Lys/Arg decarboxylase, C-terminal domain |
| 5 | PF03709.17 | 0.67 | 4 | 3807 | same-strand | Orn/Lys/Arg decarboxylase, N-terminal domain |
| 6 | PF02056.18 | 1.0 | 6 | 1055 | opposite-strand | Family 4 glycosyl hydrolase |
| 7 | PF11975.10 | 1.0 | 6 | 1055 | opposite-strand | Family 4 glycosyl hydrolase C-terminal domain |
| 8 | PF13347.8 | 1.0 | 6 | -77 | opposite-strand | MFS/sugar transport protein |
| 9 | PF05683.14 | 0.67 | 4 | 1273 | same-strand | Fumarase C-terminus |
| 10 | PF05681.16 | 0.67 | 4 | 1273 | same-strand | Fumarate hydratase (Fumerase) |
| 11 | PF03605.16 | 0.67 | 4 | 2997 | same-strand | Anaerobic c4-dicarboxylate membrane transporter |
| 12 | PF00072.26 | 0.67 | 4 | 4908 | same-strand | Response regulator receiver domain |