Result : EXP00972
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00972 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3161856 |
| Right | 3161897 |
| Strand | - |
| Nucleotide Sequence | ATGTATCCAGTGATATTTTTTTTACGCAATGCTCAATATTAA |
| Sequence | MYPVIFFLRNAQY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 12
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3449519 | 3449560 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 2 | 4035983 | 4036024 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 3293357 | 3293398 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 3285563 | 3285604 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 3800146 | 3800187 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 524008 | 524049 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 3280216 | 3280257 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 704626 | 704667 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 9 | 573936 | 573977 | + | NZ_CP050508.1 | Raoultella terrigena |
| 10 | 606119 | 606160 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 11 | 1117135 | 1117176 | - | NZ_CP026047.1 | Raoultella planticola |
| 12 | 553862 | 553903 | + | NZ_CP041247.1 | Raoultella electrica |
| 13 | 564240 | 564281 | + | NZ_LR134475.1 | Klebsiella aerogenes |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP057657.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04972.19 | 1.0 | 12 | 3011 | opposite-strand | BON domain |
| 2 | PF13580.8 | 1.0 | 12 | 2411 | opposite-strand | SIS domain |
| 3 | PF02021.19 | 1.0 | 12 | 1996 | opposite-strand | Uncharacterised protein family UPF0102 |
| 4 | PF00590.22 | 1.0 | 12 | 22 | same-strand | Tetrapyrrole (Corrin/Porphyrin) Methylases |
++ More..