Result : EXP00970
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00970 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1335030 |
| Right | 1335083 |
| Strand | - |
| Nucleotide Sequence | GTGAAAAAGAACGTGAATCCGCAGAGCCAGAAGAACTGGTTGAACCGTTCCTGA |
| Sequence | VKKNVNPQSQKNWLNRS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1348663 | 1348716 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1342935 | 1342988 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 1849505 | 1849558 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2345421 | 2345474 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2387897 | 2387950 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00563.22 | 0.75 | 3 | 1922.0 | same-strand | EAL domain |
| 2 | PF00990.23 | 0.75 | 3 | 1922.0 | same-strand | Diguanylate cyclase, GGDEF domain |
| 3 | PF00773.21 | 1.0 | 4 | -53 | same-strand | RNB domain |
| 4 | PF08206.13 | 1.0 | 4 | -53 | same-strand | Ribonuclease B OB domain |
| 5 | PF00575.25 | 1.0 | 4 | -53 | same-strand | S1 RNA binding domain |
| 6 | PF17876.3 | 1.0 | 4 | -53 | same-strand | Cold shock domain |
| 7 | PF13561.8 | 1.0 | 4 | 1535 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 8 | PF00106.27 | 1.0 | 4 | 1535 | same-strand | short chain dehydrogenase |
++ More..