Result : EXP00966
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00966 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2072261 |
| Right | 2072338 |
| Strand | - |
| Nucleotide Sequence | GCGCGGTTGCGACCTCTACGATGGCGGCGGAAGAAATTAAAGAGTTGTGTCAGAATCATAATATTCCTTTTGAATTAA |
| Sequence | ARLRPLRWRRKKLKSCVRIIIFLLN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2174458 | 2174529 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2848135 | 2848206 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 2180135 | 2180206 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1626403 | 1626474 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1284392 | 1284463 | + | NZ_CP053416.1 | Salmonella bongori |
| 6 | 3428654 | 3428725 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08220.14 | 0.8 | 4 | 2751 | same-strand | DeoR-like helix-turn-helix domain |
| 2 | PF00392.23 | 0.8 | 4 | 2751 | same-strand | Bacterial regulatory proteins, gntR family |
| 3 | PF08240.14 | 0.8 | 4 | 1597 | same-strand | Alcohol dehydrogenase GroES-like domain |
| 4 | PF00107.28 | 0.8 | 4 | 1597 | same-strand | Zinc-binding dehydrogenase |
| 5 | PF16912.7 | 0.8 | 4 | 1597 | same-strand | Glucose dehydrogenase C-terminus |
| 6 | PF13602.8 | 0.6 | 3 | 1591.0 | same-strand | Zinc-binding dehydrogenase |
| 7 | PF02302.19 | 1.0 | 5 | -71 | same-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
| 8 | PF00359.24 | 0.8 | 4 | 68.0 | same-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
| 9 | PF08013.13 | 0.8 | 4 | 530 | same-strand | D-tagatose-1,6-bisphosphate aldolase subunit GatZ/KbaZ-like |
| 10 | PF01116.22 | 0.6 | 3 | 1821.0 | same-strand | Fructose-bisphosphate aldolase class-II |
| 11 | PF00455.24 | 0.8 | 4 | 2751.0 | same-strand | DeoR C terminal sensor domain |
| 12 | PF03611.16 | 0.8 | 4 | 180.0 | same-strand | PTS system sugar-specific permease component |
++ More..