Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00964 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 3116711 |
Right | 3116752 |
Strand | - |
Nucleotide Sequence | TTGTTAGCAAGGAAAACTGTCAAAAATCTTCAAAAAATTTGA |
Sequence | LLARKTVKNLQKI |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 13 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3990172 | 3990213 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 3250412 | 3250453 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 556137 | 556178 | + | NZ_CP061527.1 | Shigella dysenteriae |
4 | 3242375 | 3242416 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
5 | 3764857 | 3764898 | - | NZ_LR134340.1 | Escherichia marmotae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF13721.8 | 1.0 | 4 | 1590 | opposite-strand | SecD export protein N-terminal TM region |
2 | PF06476.14 | 1.0 | 4 | 1075 | opposite-strand | Protein of unknown function (DUF1090) |
3 | PF19029.2 | 1.0 | 4 | 732 | opposite-strand | DUF883 C-terminal glycine zipper region |
4 | PF05957.15 | 1.0 | 4 | 732 | opposite-strand | DUF883 N-terminal domain |
5 | PF07332.13 | 1.0 | 4 | 325 | opposite-strand | Putative Actinobacterial Holin-X, holin superfamily III |
6 | PF13997.8 | 1.0 | 4 | 36 | opposite-strand | YqjK-like protein |
7 | PF07681.14 | 0.75 | 3 | 19.0 | opposite-strand | DoxX |
8 | PF13409.8 | 1.0 | 4 | 571 | opposite-strand | Glutathione S-transferase, N-terminal domain |
9 | PF13410.8 | 1.0 | 4 | 571 | opposite-strand | Glutathione S-transferase, C-terminal domain |
10 | PF05656.16 | 1.0 | 4 | 1851 | opposite-strand | Protein of unknown function (DUF805) |
11 | PF03466.22 | 0.75 | 3 | 2595.5 | same-strand | LysR substrate binding domain |
12 | PF00126.29 | 0.75 | 3 | 2595.5 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |